Novel Hypomorphic Alleles of the Mouse Tyrosinase Gene Induced by CRISPR-Cas9 Nucleases Cause Non-Albino Pigmentation Phenotypes

Abstract

Tyrosinase is a key enzyme in melanin biosynthesis. Mutations in the gene encoding tyrosinase (Tyr) cause oculocutaneous albinism (OCA1) in humans. Alleles of the Tyr gene have been useful in studying pigment biology and coat color formation. Over 100 different Tyr alleles have been reported in mice, of which ≈24% are spontaneous mutations, ≈60% are radiation-induced, and the remaining alleles were obtained by chemical mutagenesis and gene targeting. Therefore, most mutations were random and could not be predicted a priori. Using the CRISPR-Cas9 system, we targeted two distinct regions of exon 1 to induce pigmentation changes and used an in vivo visual phenotype along with heteroduplex mobility assays (HMA) as readouts of CRISPR-Cas9 activity. Most of the mutant alleles result in complete loss of tyrosinase activity leading to an albino phenotype. In this study, we describe two novel in-frame deletion alleles of Tyr, dhoosara (Sanskrit for gray) and chandana (Sanskrit for sandalwood). These alleles are hypomorphic and show lighter pigmentation phenotypes of the body and eyes. This study demonstrates the utility of CRISPR-Cas9 system in generating domain-specific in-frame deletions and helps gain further insights into structure-function of Tyr gene.

Low-density Lipoprotein Receptor-related Protein 5 (LRP5)-deficient Rats Have Reduced Bone Mass and Abnormal Development of the Retinal Vasculature

“…Lrp5 knockout rats, we used the following primers-Lrp5-E2-Fwd (CCTCACCACTCCTGTTGTTT) and Lrp5-E2-Rev (CCTGCCAGAAGAGAACCTTAC)-to amplify a 354-bp product. Anticipating that the founders would have small deletions, a heteroduplex mobility assay [27] was used to define genotypes. Amplicons were subjected to denaturation-slow renaturation to facilitate formation of heteroduplexes using a thermocycler.…”

Guidelines for Optimized Gene Knockout Using CRISPR/Cas9

“…The functional characterization of such essential genes requires the generation of heterozygous knockouts. The generation of hypomorphic alleles with the CRISPR system has been reported by different groups [12,13] but the method is not, at the moment, commonly used.…”

NF1deficiency correlates with estrogen receptor signaling and diminished survival in breast cancer

“…Genotyping was performed by amplifying a 452 bp fragment encompassing the sgRNAs target sites from DNA isolated from tail biopsies, followed by a heteroduplex mobility assay (HMA). 34 PCR amplicons with distinct HMA profiles were cloned into a plasmid vector and plasmids from multiple individual colonies were sequenced to identify the genetic lesions resulting from non-homologous end joining (NHEJ). Based on HMA profiles, indels were identified in 18 of 19 pups (Supplementary Tables 1 and 2).…”

“…as have been observed in other studies. 34,35 To verify the presence of the smaller indels and the larger in-frame deletions in each animal, we employed a three-step process of HMA, restriction digest, and Sanger sequencing ( Figure 1D-E, Supplementary Table 1-2). The majority of smaller indels 10/19 (52.6%) were detected in the 5' CRISPR target region of G0 animals.…”