2016
DOI: 10.1507/endocrj.ej16-0086
|View full text |Cite
|
Sign up to set email alerts
|

Effects of retinoic acid on growth hormone-releasing hormone receptor, growth hormone secretagogue receptor gene expression and growth hormone secretion in rat anterior pituitary cells

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
1
1
1
1

Citation Types

1
5
0

Year Published

2017
2017
2022
2022

Publication Types

Select...
6
1

Relationship

2
5

Authors

Journals

citations
Cited by 8 publications
(8 citation statements)
references
References 23 publications
1
5
0
Order By: Relevance
“…We hypothesized that MK produced in FS cells acts locally on these hormone-producing cells via PTPRZ1 in the anterior pituitary. We also reported that RA increased Ghrh-r and Ghs-r gene expression and promoted GHRH-and ghrelin-induced GH release from isolated rat anterior pituitary cells [4]. Past and present evidence suggests that RA and MK function as autocrine and paracrine signaling molecules in the anterior pituitary gland.…”
Section: Resultssupporting
confidence: 51%
See 1 more Smart Citation
“…We hypothesized that MK produced in FS cells acts locally on these hormone-producing cells via PTPRZ1 in the anterior pituitary. We also reported that RA increased Ghrh-r and Ghs-r gene expression and promoted GHRH-and ghrelin-induced GH release from isolated rat anterior pituitary cells [4]. Past and present evidence suggests that RA and MK function as autocrine and paracrine signaling molecules in the anterior pituitary gland.…”
Section: Resultssupporting
confidence: 51%
“…Anterior pituitary cells of rats were dispersed as described previously [4]. The cells (5 × 10 5 cells) were seeded in 24-well plates and then incubated at 37°C in a humidified atmosphere of 5% CO 2 and 95% air.…”
Section: Primary Culture Of Anterior Pituitary Cellsmentioning
confidence: 99%
“…Rats were housed in a temperature-controlled room (22 ± 1°C) with a 12-hour light/12-hour dark cycle and illumination from 0700 h to 1900 h, and were given ad libitum access to conventional food and water. Anterior pituitary cells of rats aged 10–12 weeks were dispersed as described previously [35]. The cells were suspended in M199 medium (Life Technologies, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.…”
Section: Methodsmentioning
confidence: 99%
“…Using ELISA, we measured the GH in both the supernatant and the cells. Since MtT/S cells express functional growth hormone-releasing hormone receptors (GHRHs), we used a human GRF to stimulate GH secretion from the cells into the supernatant [15,[26][27][28][29]. As shown in Fig.…”
Section: The Amount Of Gh Was Increased In Both the Cells And The Supmentioning
confidence: 99%
“…Reactions were performed in a SYBR Green Real-Time PCR Master Mix Plus (Toyobo, Osaka, Japan), including 0.5 μM gene-specific primer sets. The sequences of the primers used in this study are as follows: Rat and mouse GPR4 forward GCAAGCTCTTTGGCTTCATC, reverse GTGTGGTTGTAGCGATCACG; rat and mouse GH forward GGACCGCGTCTATGAGAAAC, reverse GCTTGAGGATCTGCCCAATA; rat PRL forward GCCAAAGAGATTGAGGAACAA, reverse ATGGGAGTTGTGACCAAACC; rat and mouse hypoxanthine phosphoribosyltransferase (HPRT1) forward CTTTGCTGACCTGCTGGATT, reverse TCCACTTTCGCTGATGACAC; and rat and mouse TATA box-binding protein (TBP) forward GATCAAACCCAGAATTGTTCTCC, reverse ATGTGGTCTTCCTGAATCCC.Quantification of the PCR products was performed using the comparative CT method (ΔCT method) to estimate the mRNA copy number relative to that of the TBP used as an internal standard.ELISAMtT/S cells were preincubated under the indicated pH of DMEM in the presence of 10 nM corticosterone for 2 days in 24-well multiplates[26,27]. After the pH medium was removed, the cells were further incubated with HEPES-Regular at pH 7.4 (500 µl/well) for 30 min.…”
mentioning
confidence: 99%