Diversity and oceanic distribution of the Parmales (Bolidophyceae), a picoplanktonic group closely related to diatoms

Abstract

Bolidomonas is a genus of picoplanktonic flagellated algae that is closely related to diatoms. Triparma laevis, a species belonging to the Parmales, which are small cells with a siliceous covering, has been shown to form a monophyletic group with Bolidomonas. We isolated several novel strains of Bolidophyceae that have permitted further exploration of the diversity of this group using nuclear, plastidial and mitochondrial genes. The resulting phylogenetic data led us to formally emend the taxonomy of this group to include the Parmales within the Bolidophyceae, to combine Bolidomonas within Triparma and to define a novel species, Triparma eleuthera sp. nov. The global distribution of Bolidophyceae was then assessed using environmental sequences available in public databases, as well as a large 18S rRNA V9 metabarcode data set from the Tara Oceans expedition. Bolidophyceans appear ubiquitous throughout the sampled oceans but always constitute a minor component of the phytoplankton community, corresponding to at most ~4% of the metabarcodes from photosynthetic groups (excluding dinoflagellates). They are ~10 times more abundant in the small size fraction (0.8–5 μm) than in larger size fractions. T. eleuthera sp. nov. constitutes the most abundant and most widespread operational taxonomic unit (OTU) followed by T. pacifica, T. mediterranea and the T. laevis clade. The T. mediterranea OTU is characteristic of Mediterranean Sea surface waters and the T. laevis clade OTU is most prevalent in colder waters, in particular off Antarctica.

The Physiological Response of Picophytoplankton to Temperature and Its Model Representation

“…(RCC 30), a high light (HL), and a low light (LL) ecotype of Prochlorococcus sp. (RCC 296 and 162, respectively), as well as the picoeukaryotes Bolidomonas pacifica (RCC 212), which was recently renamed as Triparma eleuthera (Ichinomiya et al, 2016), Micromonas pusilla (RCC 1677), Picochlorum sp. (RCC 289), Nannochloropsis granulata (RCC 438), Imantonia rotunda (RCC 361), and Phaeomonas sp.…”

New clade of silicified bolidophytes that belong to Triparma (Bolidophyceae, Stramenopiles)

“…), which was obtained at 5‐m depth in the Southern California Bight (San Pedro Ocean Time‐series, 33° 55′ N, 118° 40′ W) and was previously grouped in the flagellated TP clade (Ichinomiya et al . ), but is now included in the TR clade (Fig. ).…”

“…), and Parma_rbcLF1 (5′‐CGTTACGAATCTGGTGTAATT‐3′) (Ichinomiya et al . ) and rbcSR (5′‐AASHDCCTTGTGTWAGTYTC‐3′) (Daugbjerg & Andersen ), respectively. The amplified DNA fragments of 18S rDNA and rbc L were purified with a QIAquick gel extraction kit (Qiagen, Hilden, Germany) and directly sequenced (Eurofins Genomics, Tokyo, Japan).…”

“…Ichinomiya et al . (, ) successfully isolated, characterized, and phylogenetically described four silicified Triparma strains for the first time. These studies showed that Triparma and Bolidomonas are monophyletic; therefore, we combined Bolidomonas into Triparma (Ichinomiya et al .…”

Competition between Silicifiers and Non-silicifiers in the Past and Present Ocean and Its Evolutionary Impacts

“…This has been complemented by the discovery of new silicifying species (Ichinomiya et al, 2011), most notably silicon accumulation in some strains of the hugely ecologically important cyanobacteria Synechococcus (Baines et al, 2012). Combined with metagenomic surveys and geochemical monitoring (Mutsuo et al, 2015;Sunagawa et al, 2015) it will be possible to gain a much deeper knowledge of the role of different marine groups in silicon biogeochemistry and how competitive interactions govern their ecology, distribution and response to changing climatic conditions (Mock et al, 2016).…”