Use of reverse transcription loop-mediated isothermal amplification combined with lateral flow dipstick for an easy and rapid detection of Jembrana disease virus
Abstract:Jembrana disease virus (JDV) is a viral pathogen that causes Jembrana disease in Bali cattle (Bos javanicus) with high mortality rate. An easy and rapid diagnostic method is essential for further control this disease. We used a reverse transcription loop-mediated isothermal amplification (RT-LAMP) combined with lateral flow dipstick (LFD), based on conserved tm subunit of Jembrana disease virus env gene. The RT-LAMP conditions were optimized by varying the concentration of MgSO 4 , betaine, dNTP, and temperatu… Show more
“…Compared with the calcein RT-LAMP method, the method established in this experiment eliminates human error caused by visual observation of color, and the test is completed in a closed container, thus eliminating false-positive amplification caused by additional contamination of fluorescent dye in the RT-LAMP product. In some studies, only one labeled primer was used in the LAMP reaction[36, 37], and another labeled probe was added to the LAMP products to form a double-labeled detectable product, which easily caused contamination of the LAMP product. In our study, the two internal primers were labeled with biotin isothiocyanate and fluorescein isothiocyanate respectively.…”
Senecavirus A (SVA) is a critical pathogen causing vesicular lesions in sows and acute death of newborn piglets, resulting in very large economic losses in the pig industry. To restrict the transmission of SVA, an establishment of an effective diagnostic method is crucial for the prevention and control of the disease. However, traditional detection methods often have many drawbacks. In this study, reverse transcription loop-mediated isothermal amplification (RT-LAMP) was combined with a lateral flow dipstick (LFD) to detect SVA. The resulting RT-LAMP-LFD assay was performed at 60°C for 50 min and then directly judged on an LFD visualization strip. This method shows high specificity and sensitivity to SVA. The detection limit of RT-LAMP was 4.56x10
-8
ng/μL RNA, approximately 11 copies/μL RNA, and it was 10 times more sensitive than RT-PCR. This detection method’s positive rate for clinical samples is comparable to that of RT-PCR. This method is time saving and highly efficient and is thus expected to be used to diagnose SVA infections in this field.
“…Compared with the calcein RT-LAMP method, the method established in this experiment eliminates human error caused by visual observation of color, and the test is completed in a closed container, thus eliminating false-positive amplification caused by additional contamination of fluorescent dye in the RT-LAMP product. In some studies, only one labeled primer was used in the LAMP reaction[36, 37], and another labeled probe was added to the LAMP products to form a double-labeled detectable product, which easily caused contamination of the LAMP product. In our study, the two internal primers were labeled with biotin isothiocyanate and fluorescein isothiocyanate respectively.…”
Senecavirus A (SVA) is a critical pathogen causing vesicular lesions in sows and acute death of newborn piglets, resulting in very large economic losses in the pig industry. To restrict the transmission of SVA, an establishment of an effective diagnostic method is crucial for the prevention and control of the disease. However, traditional detection methods often have many drawbacks. In this study, reverse transcription loop-mediated isothermal amplification (RT-LAMP) was combined with a lateral flow dipstick (LFD) to detect SVA. The resulting RT-LAMP-LFD assay was performed at 60°C for 50 min and then directly judged on an LFD visualization strip. This method shows high specificity and sensitivity to SVA. The detection limit of RT-LAMP was 4.56x10
-8
ng/μL RNA, approximately 11 copies/μL RNA, and it was 10 times more sensitive than RT-PCR. This detection method’s positive rate for clinical samples is comparable to that of RT-PCR. This method is time saving and highly efficient and is thus expected to be used to diagnose SVA infections in this field.
“…Lateral flow dipstick (LFD) was developed as well for simultaneous detection of pathogenic Leptospira spp. (Nurul Najian et al 2016), measles virus (Xu et al 2016), animal babesiosis, caused by Babesia bovis and Babesia bigemina , foot-and-mouth diseases (Waters et al 2014), Japanese encephalitis (Deng et al 2015), P. vivax, and P. falciparum (Yongkiettrakul et al 2014;Kongkasuriyachai et al 2017), Jembrana disease virus (Kusumawati et al 2015), canine parvovirus (Sun et al 2014), Vibrio alginolyticus (Plaon et al 2015), Macrobrachium rosenbergii nodavirus and shrimp yellow head virus (Khunthong et al 2013).…”
“…al., 2021). Research on the use of LFD for NALFIA / NALF has been carried out for detecting pathogenic diseases in both animals and humans (Ding et al, 2010;Nimitphak et al, 2010;Kusumawati et al, 2015, Kusumawati andFatimah, 2018;Ajie et. al., 2021).…”
Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.Keywords : capture probe; dengue virus; hybridization; nucleic acid lateral flow; serotyping
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.