D-loop somatic mutations and ∼5 kb “common” deletion in mitochondrial DNA: important molecular markers to distinguish oral precancer and cancer

Abstract

Apart from genomic DNA, mutations at mitochondrial DNA (mtDNA) have been hypothesized to play vital roles in cancer development. In this study, ∼5 kb deletion and D-loop mutations in mtDNA and alteration in mtDNA content were investigated in buccal smears from 104 healthy controls and 74 leukoplakia and 117 cancer tissue samples using Taqman-based quantitative assay and re-sequencing. The ∼5 kb deletion in mtDNA was significantly less (9.8 and 10.5 folds, P < 0.0001) in cancer tissues compared to control and leukoplakia tissues, respectively. On the other hand, somatic mutations in D-loop, investigated in 54 controls, 50 leukoplakias and 56 cancer patients, were found to be significantly more in cancer tissues, but not in leukoplakia tissues, compared to control (Z-score = 5.4). MtDNA contents were observed to be significantly more in leukoplakia (2.1 folds, P = 0.004) and cancer (1.6 folds, P = 0.03) tissues compared to control tissues. So, D-loop somatic mutations and ∼5 kb deletion patterns could be used as distinguishing markers between precancer and cancer tissues. This observation further suggests that somatic mutations in D-loop may facilitate carcinogenesis and cancer cells with less ∼5 kb deletion, i.e., intact mtDNA, may become resistant to apoptosis.

Programmed Switch in The Mitochondrial Degradation Pathways During Human Retinal Ganglion Cell Differentiation from Stem Cells is Critical for RGC Survival

“…DNA was isolated from the cell pellets using DNeasy Blood and Tissue kit (Qiagen) followed by simultaneous quantification of the mitochondrial and nuclear DNA content within the same sample using Taqman chemistry (Thermo Fisher) with StepOnePlus Real-Time PCR system (Applied Biosystems). Human mitochondrial DNA was detected via measurement of the very stable region on the mitochondrial ND1 gene [35] using following primers [36]; forward: 5’ CCTTCGCTGACGCCATAAA3’, reverse: 5’TGGTAGATGTGGCGGGTTTT3’, ND1-probe: 6FAM-5’TCTTCACCAAAGAGCC3’-MGBNFQ (6FAM and the MGBNFQ are the fluorescence reporter and quencher respectively). For an internal control, nuclear DNA content was measured using the human RNase P gene (TaqMan Copy Number Reference assay Catalog # 4403326).…”

Aspartate β-hydroxylase disrupts mitochondrial DNA stability and function in hepatocellular carcinoma

“…To detect mutations in the D-loop region of mtDNA, we used mtDNA extracted from paired HCC tissues or multiple clones of HCC cell lines cultured from single tumor cells to reflect the intrinsic heterogeneity of mtDNA. The D-loop region was amplified as previously described, 41 using primers listed in Supplementary Table S3 . Additional information on PCR procedures is detailed in the Supplementary Information .…”

Mitochondrial DNA mutations and dysfunctions in oral carcinogenesis

“…Secondly, what is exact demarcation of effects between each type of mutation? Thirdly, which type of mutation has a greater role in tumour initiation and progression [46,114].…”

“…Mitochondria plays a key role in tumorigenesis as mitochondrial dysfunction either becoming the driving cause of tumorigenesis or as a 'second hit' in the process of cancer metabolic transformation [46,114]. In both the cases, however, metabolic reprogramming increases the cancer cells' survival and proliferation advantage by increasing ATP production in an oxygen independent manner and providing building blocks for macromolecule biosynthesis.…”