SUV39H1/H3K9me3 attenuates sulforaphane-induced apoptotic signaling in PC3 prostate cancer cells

Abstract

The isothiocyanate sulforaphane is a promising molecule for development as a therapeutic agent for patients with metastatic prostate cancer. Sulforaphane induces apoptosis in advanced prostate cancer cells, slows disease progression in vivo and is well tolerated at pharmacological doses. However, the underlying mechanism(s) responsible for cancer suppression remain to be fully elucidated. In this investigation we demonstrate that sulforaphane induces posttranslational modification of histone methyltransferase SUV39H1 in metastatic, androgen receptor-negative PC3 prostate cancer cells. Sulforaphane stimulates ubiquitination and acetylation of SUV39H1 within a C-terminal nuclear localization signal peptide motif and coincides with its dissociation from chromatin and a decrease in global trimethyl-histone H3 lysine 9 (H3K9me3) levels. Exogenous SUV39H1 expression leads to an increase in H3K9me3 and decreases sulforaphane-induced apoptotic signaling. SUV39H1 is thus identified as a novel mediator of sulforaphane cytotoxicity in PC3 cells. Our results also suggest SUV39H1 dynamics as a new therapeutic target in advanced prostate cancers.

Ubiquitination of Lysine 867 of the Human SETDB1 Protein Upregulates Its Histone H3 Lysine 9 (H3K9) Methyltransferase Activity

“…O-GlcNAcylation of EZH2 is known to upregulate the stability of EZH2 and increase cellular histone H3 lysine 27 trimethylation level. Sulforaphane-induced PTMs (acetylation and ubiquitination) of suppressor of variegation 3–9, drosophila, homolog 1 (SUV39H1) decreases histone H3 lysine 9 (H3K9) trimethylation, leading to enhanced apoptotic signaling in metastatic prostate cancer cells [4]. H3K9 methyltransferase G9a is a self-methylating lysine methyltransferase that mediates the in vivo interaction with the epigenetic regulator heterochromatin protein 1 [5].…”

Assessment of global proteome in LNCaP cells by 2D-RP/RP LC–MS/MS following sulforaphane exposure

“…Sulforaphane is known to stimulate global changes in gene expression and has been shown to enhance protein degradation through the proteasome in some cell types, including metastatic prostate cancer cells [2, 3, 9, 19, 29–33]. This suggests a remodeling of the cellular proteome following exposure.…”

“…Methods for 1D LC-MS/MS have been described previously [19]. Waters 2D nano acquity UPLC system (Waters Corp., Milford, MA, USA) in “2D with dilution” configuration was used for the 2-dimentional analysis.…”

“…Raw data files were analyzed using Mascot and X!Tandem database searching algorithms according to the protocol listed previously [19]. Data comparison and quantification was carried out using Scaffold_3.3.1 (Proteome Software, Portland, OR, USA).…”

“…TRIAP1 was amplified from LNCaP cDNA prepared as described previously [19] using the following primers: Sense 5′ – TACTACTTAAGCTTATGAACAGTGTGGGGGAGGCATGCACGGACATGAA – 3′, Antisense 5′ – TCTGAGAGCGGCCGCTTAATTAATTATCAAGAAGAATTTTCAGGCTTTTCTTTGCCATG – 3′. The amplification product was cloned into a pCR2.1 TOPO TA cloning vector in accordance with the manufacturer’s protocol (Life Technologies).…”