PET-PCR method for the molecular detection of malaria parasites in a national malaria surveillance study in Haiti, 2011

Lucchi, Naomi W.; Karell, Mara A.; Journel, Ito; Rogier, Eric; Goldman, Ira F.; Ljolje, Dragan; Huber, Curtis S.; Mace, Kimberly E.; Jean, Samuel E.; Akom, Eniko; Oscar, Roland; Buteau, Josiane; Boncy, Jacques; Barnwell, John W.; Udhayakumar, Venkatachalam

doi:10.1186/1475-2875-13-462

Cited by 53 publications

(69 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For the area of low P. falciparum endemicity, a tracking results continuously (TRaC) survey was conducted in 2012 as part of Global Fund’s Round 8 activities that builds on the Strategic Plan against Malaria in Haiti. A 2011 nationwide survey reported Haiti to have a low national parasite prevalence of less than 1 % as estimated by PCR [ 16 ]. The 2012 survey was cross-sectional and implemented by Population Services International (PSI) utilizing a community-based household design in collaboration with Haiti’s Ministry of Health (MSPP) and the Centers for Disease Control and Prevention (CDC).…”

Section: Methodsmentioning

confidence: 99%

Multiple comparisons analysis of serological data from an area of low Plasmodium falciparum transmission

Rogier

Wiegand

Moss

et al. 2015

Malar J

Self Cite

View full text Add to dashboard Cite

BackgroundAs a nation reduces the burden of falciparum malaria, identifying areas of transmission becomes increasingly difficult. Over the past decade, the field of utilizing malaria serological assays to measure exposure has grown rapidly, and a variety of serological methods for data acquisition and analysis of human IgG against falciparum antigens are available. Here, different immunoassays and statistical methods are utilized to analyse samples from a low transmission setting and directly compare the estimates generated.MethodsA subset of samples (n = 580) from a 2012 Haitian nationwide malaria survey was employed as sample population of low falciparum endemicity. In addition to the Haitian samples, samples from 247 US residents were used as a reference population of ‘true seronegatives’. Data acquisition was performed through standard ELISA and bead-based multiplex assays assaying for IgG antibodies to the Plasmodium falciparum antigens MSP-1p19, MSP-1p42(D), MSP-1p42(F), and AMA-1. Appropriate parametric distributions and seropositivity cutoff values were determined by statistical measures.ResultsData from both assays showed a strong positive skew, and the lognormal distribution was found to be an appropriate statistical fit to the Haitian and American populations. The American samples served as a good serological true negative population for the multiplex assay, but not for ELISA-based data. Mixture model approaches to determine seronegative and seropositive populations from the Haitian data showed a high degree of distribution overlap—likely due to the historical low falciparum transmission in this nation. Different fittings to the reversible catalytic model resulted depending upon the immunoassay utilized and seropositivity cutoff method employed. Data were also analysed through fitting to penalized B-splines, presenting another possible analytical tool for the analysis of malaria serological data.ConclusionsStandardization of serological techniques and analyses may prove difficult as some tools can prove to be more useful depending on the area and parasite in question, making clear interpretation a vital pursuit. The presented analysis in the low-endemic nation of Haiti found malaria-naive US residents to be an appropriate seronegative reference population for the multiplex assay, and this assay providing consistent estimates between MSP-1 and AMA-1 antigens of percent seropositives for this low-endemic population.Electronic supplementary materialThe online version of this article (doi:10.1186/s12936-015-0955-1) contains supplementary material, which is available to authorized users.

show abstract

Section: Methodsmentioning

confidence: 99%

Multiple comparisons analysis of serological data from an area of low Plasmodium falciparum transmission

Rogier

Wiegand

Moss

et al. 2015

Malar J

Self Cite

View full text Add to dashboard Cite

show abstract

“…Dried blood spots, on Whatman 903 protein saver cards, were analysed in duplicate by LNSP in June 2014 by polymerase chain reaction using photo-induced electron transfer fluorogenic genus-specific primers (PET-PCR). Sample preparation, storage, extraction, and assays were performed using protocols described previously [ 10 , 14 ], but modified to account for World Health Organization (WHO) Evidence Review Group recommendations made in March 2014 for PCR analysis in low transmission settings [ 15 ]. Briefly, the amplification of Plasmodium genus (5′–3′, forward primer: GCTCTTTCTTGATTTCTTGGATG; reverse primer: FAM-aggcgcatagcgcctgg AGCAGGTTAAGATCTCGTTCG) was performed in a 30 µL reaction containing 2X TaqMan Environmental buffer 2.0 (Applied BioSystems, Grand Island, NY, USA), 400 nm each of forward and reverse primers.…”

Section: Methodsmentioning

confidence: 99%

“…A community-based survey conducted in the Artibonite Valley during the rainy season of 2006 estimated a 3.1% prevalence of malaria by polymerase chain reaction (PCR) [ 9 ]. In 2011, a national community survey showed that, by all methods (microscopy, RDT and PCR), less than one percent of persons were parasitemic [ 10 ].…”

Section: Introductionmentioning

confidence: 99%

Evaluation of case management of uncomplicated malaria in Haiti: a national health facility survey, 2012

Landman

Jean²,

Existe³

et al. 2015

Malar J

View full text Add to dashboard Cite

BackgroundMalaria is a public health concern in Haiti, although there are limited data on its burden and case management. National malaria guidelines updated in 2012 recommend treatment with chloroquine and primaquine. In December 2012, a nationally-representative cross-sectional survey of health facilities (HFs) was conducted to determine malaria prevalence among febrile outpatients and malaria case management quality at baseline before scale-up of diagnostics and case management training.MethodsAmong all 833 HFs nationwide, 30 were selected randomly, in proportion to total HFs per region, for 2-day evaluations. Survey teams inventoried HF material and human resources. Outpatients of all ages were screened for temperature >37.5 °C or history of fever; those without severe symptoms were consented and enrolled. Providers evaluated and treated enrolled patients according to HF standards; the survey teams documented provider-ordered diagnostic tests and treatment decisions. Facility-based test results [microscopy and malaria rapid diagnostic tests (RDTs)] were collected from HF laboratories. Blood smears for gold-standard microscopy, and dried blood spots for polymerase chain reaction (PCR) were obtained.ResultsMalaria diagnostic capacity, defined as completing a test for an enrolled patient or having adequate resources for RDTs or microscopy, was present in 11 (37 %) HFs. Among 459 outpatients screened, 257 (56 %) were febrile, of which 193 (75 %) were eligible, and 153 (80 %) were enrolled. Among 39 patients with facility-level malaria test results available on the survey day, 11 (28 %) were positive, of whom 6 (55 %) were treated with an anti-malarial. Twenty-seven (95 %) of the 28 patients testing negative were not treated with an anti-malarial. Of 114 patients without test results available, 35 (31 %) were presumptively treated for malaria. Altogether, 42 patients were treated with an anti-malarial, one (2 %) according to Haiti’s 2012 guidelines. Of 140 gold-standard smears, none were positive, although one patient tested positive by PCR, a more sensitive technique. The national prevalence of malaria among febrile outpatients is estimated to be 0.5 % (95 % confidence interval 0–1.7 %).ConclusionsMalaria is an uncommon cause of fever in Haitian outpatients, and limited, often inaccurate, diagnostic capacity at baseline contributes to over diagnosis. Scale-up of diagnostics and training on new guidelines should improve malaria diagnosis and treatment in Haiti.

show abstract

“…Parasite genomic deoxyribonucleic acid (DNA), from lter paper and RDTs was extracted using QIAamp DNA Mini kit (Qiagen, QIAGEN, USA) according to the manufacturer's instructions. P. falciparum molecular identi cation was performed using the photo-induced electron transfer (PET)-PCR assay [33] on a Roche LightCycler 96 instrument (Roche Molecular Systems, Inc). Each experimental run included both a negative (no template) and a positive (3D7 P. falciparum strain) control.…”

Section: Multiplex Pcr Ampli Cation Of Pfmsp1 and Pfmsp2 Genesmentioning

confidence: 99%

“…Each experimental run included both a negative (no template) and a positive (3D7 P. falciparum strain) control. Samples with a cycle threshold (CT) of 40 or less were scored as positive [33][34]. The two Pfmsp1 and Pfmsp2 polymorphic genes were ampli ed by multiplex PCR.…”

Section: Multiplex Pcr Ampli Cation Of Pfmsp1 and Pfmsp2 Genesmentioning

confidence: 99%

Molecular Epidemiology of Plasmodium Falciparum by Multiplexed Amplicon Deep Sequencing in Senegal

Ndiaye

Gaye

et al. 2020

Preprint

View full text Add to dashboard Cite

Background Molecular epidemiology can provide important information regarding the genetic diversity and transmission of Plasmodium falciparum, which can assist in designing and monitoring elimination efforts. However, malaria molecular epidemiology including understanding the genetic diversity of the parasite and performing molecular surveillance of transmission has been poorly documented in Senegal. Next Generation Sequencing (NGS) offers a practical, fast and high-throughput approach to understand malaria population genetics. This study aims to unravel the population structure of P. falciparum and to estimate the allelic diversity, multiplicity of infection (MOI), and evolutionary patterns of the malaria parasite using the NGS platform. Methods Multiplex amplicon deep sequencing of merozoite surface protein 1 (PfMSP1) and merozoite surface protein 2 (PfMSP2) genes in fifty-three P. falciparum isolates from two epidemiologically different areas in the South and North of Senegal, was carried out. Results A total of 76 Pfmsp1 and 116 Pfmsp2 clones were identified and 135 different alleles were found, 56 and 79 belonged to the pfmsp1 and pfmsp2 genes, respectively. K1 and IC3D7 allelic families were most predominant in both sites. The local haplotype diversity (Hd) and nucleotide diversity (π) were higher in the South than in the North for both genes. For pfmsp1, a high positive Tajima’s D (TD) value was observed in the South (D = 2.0453) while negative TD value was recorded in the North (D=-1.46045) and F-Statistic (Fst) was 0.19505. For pfmsp2, non-directional selection was found with a highly positive TD test in both areas and Fst was 0.02111. The mean MOI for both genes was 3.07 and 1.76 for the South and the North, respectively, with a statistically significant difference between areas (p = 0.001). Conclusion This study revealed a high genetic diversity of pfmsp1 and pfmsp2 genes and low genetic differentiation in P. falciparum population in Senegal. The MOI means were significantly different between the Southern and Northern areas. Findings also showed that multiplexed amplicon deep sequencing is a useful technique to investigate genetic diversity and molecular epidemiology of P. falciparum infections.

show abstract

PET-PCR method for the molecular detection of malaria parasites in a national malaria surveillance study in Haiti, 2011

Cited by 53 publications

References 19 publications

Multiple comparisons analysis of serological data from an area of low Plasmodium falciparum transmission

Multiple comparisons analysis of serological data from an area of low Plasmodium falciparum transmission

Evaluation of case management of uncomplicated malaria in Haiti: a national health facility survey, 2012

Molecular Epidemiology of Plasmodium Falciparum by Multiplexed Amplicon Deep Sequencing in Senegal

Contact Info

Product

Resources

About