Intracellular glycine receptor function facilitates glioma formation in vivo

Abstract

BSTRACTThe neuronal function of Cys-loop neurotransmitter receptors is established; however, their role in non-neuronal cells is poorly defined. As brain tumors are enriched in the neurotransmitter glycine, we studied the expression and function of glycine receptors (GlyRs) in glioma cells. Human brain tumor biopsies selectively expressed the GlyR a1 and a3 subunits, which have nuclear localization signals (NLSs). The mouse glioma cell line GL261 expressed GlyR a1, and knockdown of GlyR a1 protein expression impaired the self-renewal capacity and tumorigenicity of GL261 glioma cells, as shown by a neurosphere assay and GL261 cell inoculation in vivo, respectively. We furthermore showed that the pronounced tumorigenic effect of GlyR a1 relies on a new intracellular signaling function that depends on the NLS region in the large cytosolic loop and impacts on GL261 glioma cell gene regulation. Stable expression of GlyR a1 and a3 loops rescued the self-renewal capacity of GlyR a1 knockdown cells, which demonstrates their functional equivalence. The new intracellular signaling function identified here goes beyond the well-established role of GlyRs as neuronal ligand-gated ion channels and defines NLS-containing GlyRs as new potential targets for brain tumor therapies.

Targeting cancer stem‐like cells in glioblastoma and colorectal cancer through metabolic pathways

“…This metabolic adaption makes the highly malignant hypoxic GBM cells susceptible to efficient cellular glycine clearance, suggesting a novel therapeutic treatment route by forcing the toxic over‐accumulation of glycine in the cytoplasm . In addition, intracellular glycine receptor signaling has recently been shown to promote glioma formation, Pseudopalisades have increased expression of glucose uptake transporter 1 (GLUT1) as compared with parenchymal cells indicating elevated carbon nutrition in CSCs residing in that area . This study suggests a dependence on glucose during hypoxia; however, CSCs have also been shown to possess a high tolerance to glucose deprivation.…”

Modulation of glycine receptor single-channel conductance by intracellular phosphorylation

“…An increasing number of studies have suggested in addition that GlyRs are also expressed in supraspinal sites 5,6,[9][10][11]59,60 . Interestingly, recent immunocytochemical and gene expression studies have determined that α3GlyRs are expressed in brainstem, trigeminal ganglia, nucleus accumbens and the hippocampus 17,20,21,23,[59][60][61] . Despite the absence of specific pharmacological tools to identify α3GlyRs, the presence of functional α3-containing GlyRs in several CNS areas has been inferred by using mice lacking α3GlyRs.…”

Presence of ethanol‐sensitive glycine receptors in medium spiny neurons in the mouse nucleus accumbens

“…The following primers were used for conventional and real‐time qPCR: GlyR α1 forward 5′‐CTGTTTGCCTGCTCTTCGTGT‐3′ and reverse 5′‐TGGGGAAACCGATGCGAGATA‐3′; GlyR α2A forward 5′‐ATCAACAGTTTTGGATCGGTCA‐3′, GlyR α2B forward 5′‐TCAACAGCTTTGGGTCAATAG‐3′ and GlyR α2 reverse 5′‐CCTTCAGCAACTTGTACTGG‐3′; GlyR α3 forward 5′‐TGGGTACACGATGAATGATCTC‐3′ and reverse 5′‐TTAGCCCTGTCGATGAAGACC‐3′; GlyR β forward 5′‐TGAGCAAGCAGATGGGAAAGG‐3′ and reverse 5′‐TAACGTTGAAGAACAAGAAGCAG‐3′ (Forstera et al . ). The following primers were used for real‐time qPCR: GlyR α1 forward 5′‐CTGTTTGCCTGCTCTTCGTGT‐3′ and reverse 5′‐TGGGGAAACCGATGCGAGATA‐3′, GlyR α2 forward 5′‐ATCAATGGGAAGGACATCAGGA‐3′ and reverse 5′‐GTTATCAGTGGTGACATCATGG‐3′; GlyR α3 forward 5′‐TGGGTACACGATGAATGATCTC‐3′ and reverse 5′‐TTAGCCCTGTCGATGAAGACC‐3′; GlyR β forward 5′‐ACGCAGCTAAGAAGAACACTGTGA‐3′ and reverse 5′‐CCAAGTTCCATTGTTGACTTCAATG‐3′ (Kuhse et al .…”