Draft Genome Sequences of Type Strain Sediminibacterium salmoneum NJ-44 and
            <i>Sediminibacterium</i>
            sp. Strain C3, a Novel Strain Isolated from Activated Sludge

Ayarza, Joaquín M.; Figuerola, Eva Lucia Margarita; Erijman, Leonardo

doi:10.1128/genomea.01073-13

Cited by 15 publications

(11 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Genomic comparisons were performed between the six SAGs and the genomes of Hydrotalea flava CCUG 51397 T (LUHG00000000.1), Hydrotalea sandarakina AF‐51 T (JGI Project Id: 1049057) and Sediminibacterium salmoneum NJ‐44 T (NZ_AXZP00000000.1) (Ayarza, Figuerola, & Erijman, ). The genome of Hydrotalea flava CCUG 51397 T was previously sequenced by our group (Leite et al., ) and detailed here for the first time.…”

Section: Methodsmentioning

confidence: 99%

Single‐cell sequencing unveils the lifestyle and CRISPR‐based population history of Hydrotalea sp. in acid mine drainage

et al. 2017

View full text Add to dashboard Cite

Acid mine drainage (AMD) is characterized by an acid and metal-rich run-off that originates from mining systems. Despite having been studied for many decades, much remains unknown about the microbial community dynamics in AMD sites, especially during their early development, when the acidity is moderate. Here, we describe draft genome assemblies from single cells retrieved from an early-stage AMD sample. These cells belong to the genus Hydrotalea and are closely related to Hydrotalea flava. The phylogeny and average nucleotide identity analysis suggest that all single amplified genomes (SAGs) form two clades that may represent different strains. These cells have the genomic potential for denitrification, copper and other metal resistance. Two coexisting CRISPR-Cas loci were recovered across SAGs, and we observed heterogeneity in the population with regard to the spacer sequences, together with the loss of trailer-end spacers. Our results suggest that the genomes of Hydrotalea sp. strains studied here are adjusting to a quickly changing selective pressure at the microhabitat scale, and an important form of this selective pressure is infection by foreign DNA.

show abstract

Section: Methodsmentioning

confidence: 99%

Single‐cell sequencing unveils the lifestyle and CRISPR‐based population history of Hydrotalea sp. in acid mine drainage

et al. 2017

View full text Add to dashboard Cite

show abstract

“…Comparisons between gels (detection, quantification, and spot matching) were performed using Image Master 2D Platinum 7.0 software (GE Healthcare Life Sciences). Protein spots of interest were cut out, digested with trypsin and analyzed by MALDI‐TOF‐MS (Institut Pasteur de Montevideo, Uruguay), using the annotated draft genome as an in‐house database.…”

Section: Methodsmentioning

confidence: 99%

“…Specific primers for the universal stress protein gene USP gene of Sediminibacterium sp. C3 USP23F (5′‐CCGATTTTTCTGCTACCGCC‐3′) and USP221R (5′‐TCAGCCCTGAACTGCAAGAG‐3′) were designed using the Primer‐BLAST tool available from the NCBI web site (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and the draft Sediminibacterium sp. C3 genome sequence.…”

Section: Methodsmentioning

confidence: 99%

“…A high quality draft of the genome sequence of strain Sediminibacterium sp. C3 is now available . This strain was unique, in that it exhibited microaerophilic planktonic growth in low concentration media, but aggregated growth occurred in media containing high concentration of organic substrates or in diluted media containing relatively low concentration of pyruvate (0.07% w/v).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Expression of stress-related proteins inSediminibacteriumsp. growing under planktonic conditions

Ayarza

Mazzella

Erijman

2015

J. Basic Microbiol.

Self Cite

View full text Add to dashboard Cite

Aggregation is a common trait of bacteria in natural and engineered biological systems. Microbial aggregates, such as flocs, granules, and biofilms, are spatially heterogeneous environments. It is generally observed that by growing under aggregated conditions bacteria respond and adapt to environmental stress better than free-swimming bacteria of the same species. We performed a proteomic analysis of a strain of Sediminibacterium, isolated from activated sludge, which grew planktonically in diluted culture media and in an aggregated form in media containing a high concentration of organic substrate. Auto-aggregation was also observed in the presence of pyruvate in dilute media. Expression of a number of stress-related proteins significantly increased under planktonic growth in comparison to aggregate growth. The upregulated proteins, identified by MALDI-TOF mass spectrometry, were two isoforms of a protein belonging to the universal stress family (UspA), a thioredoxin-disulfide reductase, the Campylobacter jejuni orthologue transcriptional regulator (Cj1172c), and the CocE/NonD hydrolase. We conclude that Sediminibaterium sp. C3 growth is stressed under planktonic conditions and that aggregation induced by pyruvate protects the bacteria against oxidative stress.

show abstract

“…The relatively low growth rates might have been exceeded by higher flow-through as observed during the cooling period. Sediminibacterium, affiliated to Bacteroidetes, has been isolated from sediment (Qu & Yuan, 2008), soil (Kim et al, 2013), and activated sludge (Ayarza et al, 2014). Nutrient supply and temperature were most closely related to Sediminibacterium net production and growth (Sander & Kalff, 1993).…”

Section: Short-term Succession Of the Bacterial Community Related To mentioning

confidence: 99%

Resilience of planktonic bacterial community structure in response to short-term weather deterioration during the growing season in an alpine lake

Jiang

Elbehery

et al. 2019

Hydrobiologia

View full text Add to dashboard Cite

The disturbing effect of a short-term cooling period during summer on planktonic bacterial community structure of an alpine lake was investigated using 16S rDNA pyrosequencing. Proteobacteria, Actinobacteria, and Bacteroidetes constituted the most abundant phyla. During the sampling period (from July to August 2010), a sudden cooling period with high precipitation occurred, as indicated by a decrease in conductivity, calcium, and dissolved organic carbon concentration resulting from increased runoff. The relative abundance of Actinobacteria, Betaproteobacteria, and Cyanobacteria decreased during this short-term cooling period. Instead, a rapid shift from Betaproteobacteria to Gammaproteobacteria occurred, which was mainly caused by an increase of Acinetobacter rhizosphaerae. Soon after the shortterm cooling period, warmer weather conditions got re-established and Betaproteobacteria recovered and became again dominant. Non-metric multi-dimensional scaling analysis and Venn diagrams revealed a planktonic bacterial community composition with high similarity at the beginning and the end of the growing season. Air temperature and precipitation were significantly correlated with the observed variation in operational taxonomic unit (OTU) relative abundance. It is concluded that, in response to the short-term cooling period, a distinct planktonic bacterial OTU community developed. It rapidly diminished, however, as summer conditions became reestablished, implying the recovery of the original bacterial community structure.

show abstract

Draft Genome Sequences of Type Strain Sediminibacterium salmoneum NJ-44 and Sediminibacterium sp. Strain C3, a Novel Strain Isolated from Activated Sludge

Cited by 15 publications

References 10 publications

Single‐cell sequencing unveils the lifestyle and CRISPR‐based population history of Hydrotalea sp. in acid mine drainage

Single‐cell sequencing unveils the lifestyle and CRISPR‐based population history of Hydrotalea sp. in acid mine drainage

Expression of stress-related proteins inSediminibacteriumsp. growing under planktonic conditions

Resilience of planktonic bacterial community structure in response to short-term weather deterioration during the growing season in an alpine lake

Contact Info

Product

Resources

About