G-Protein-Coupled Receptor Kinase-5 Mediates Inflammation but Does Not Regulate Cellular Infiltration or Bacterial Load in a Polymicrobial Sepsis Model in Mice

Packiriswamy, Nandakumar; Lee, Taehyung; Raghavendra, Pongali B.; Durairaj, Haritha; Wang, Hongbing; Parameswaran, Narayanan

doi:10.1159/000347002

Cited by 30 publications

(45 citation statements)

References 44 publications

(67 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To determine the relative levels of a specific RNA transcript, RNA was isolated from snap-frozen tissue using the Qiagen RNeasy minikit according to the manufacturer's protocol and as described earlier (40). Reverse transcription (RT) was carried out with 1 g of RNA using the Promega cDNA synthesis kit.…”

mentioning

confidence: 99%

“…Reverse transcription (RT) was carried out with 1 g of RNA using the Promega cDNA synthesis kit. Quantitative RT-PCR (qRT-PCR) was performed with ABI Fast 7500 (Applied Biosystems), and all genes were normalized to hypoxanthine phosphoribosyltransferase (HPRT) as previously described (40). The following primers were used for the respective genes: tumor necrosis factor alpha (TNF-␣) forward, TCT CATCAGTTCTATGGCCC-3; TNF-␣ reverse, GGGAGTAGACAAGCT ACAAC; IB␣ forward, TGG CCA GTG TAG CAG TCT TG; IB␣ reverse, GAC ACG TGT GGC CAT TGT AG; interleukin 6 (IL-6) forward, ACA AGT CGG AGG CTT AAT TAC ACA T; IL-6 reverse, TTG CCA TTG CAC AAC TCT TTT C; keratinocyte chemoattractant (KC) forward, CTTGAAGGTGTTGCCCTGAG; KC reverse, TGGGGACACCTTTTAG CATC; macrophage inflammatory protein 2 (MIP2) forward, GGCAAG GCTAACTGACCTGGAAAGG; MIP2 reverse, ACAGCGAGGCACATG AGGTACGA; HPRT forward, AAG CCT AAG ATG AGC GCA AG; HPRT reverse, TTA CTA GGC AGA TGG CCA CA.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Gene Dosage-Dependent Negative Regulatory Role of β-Arrestin-2 in Polymicrobial Infection-Induced Inflammation

et al. 2013

Self Cite

View full text Add to dashboard Cite

␤-arrestin-2 (␤-arr2) is a scaffolding protein of the arrestin family with a wide variety of cellular functions. Recent studies have demonstrated differential roles for ␤-arr2 in inflammation following endotoxemia and cecal ligation and puncture (CLP) models of sepsis. Because CLP-induced inflammation involves response to fecal contents and necrotic cecum in addition to microbial challenge, in this study, we examined the role of ␤-arr2 in an exclusively polymicrobial infection (PMI) model. In addition, we examined the role of gene dosage of ␤-arr2 in polymicrobial sepsis. Our studies demonstrate that ␤-arr2 is a negative regulator of systemic inflammation in response to polymicrobial infection and that one allele is sufficient for this process. Our results further reveal that loss of ␤-arr2 leads to increased neutrophil sequestration and overt inflammation specifically in the lungs following polymicrobial infection. Consistent with this, specific NF-B and mitogen-activated protein kinase (MAPK) signaling pathways were differentially activated in the ␤-arr2 knockout (KO) mice lungs compared to the wild type (WT) following PMI. Associated with enhanced inflammation in the KO mice, PMI-induced mortality was also significantly higher in KO mice than in WT mice. To understand the differential role of ␤-arr2 in different sepsis models, we used cell culture systems to evaluate inflammatory cytokine production following endotoxin and polymicrobial stimulation. Our results demonstrate cell-type-as well as stimulus-specific roles for ␤-arr2 in inflammation. Taken together, our results reveal a negative regulatory role for ␤-arr2 in polymicrobial infection-induced inflammation and further demonstrate that one allele of ␤-arr2 is sufficient to mediate most of these effects.

show abstract

mentioning

confidence: 99%

mentioning

confidence: 99%

Gene Dosage-Dependent Negative Regulatory Role of β-Arrestin-2 in Polymicrobial Infection-Induced Inflammation

et al. 2013

Self Cite

View full text Add to dashboard Cite

show abstract

“…Furthermore, GRK5 levels have been shown to be modulated in different disease conditions, including neurodegenerative disorders (14), cancers (15), sepsis (16), and cardiac failure (17,18). In recent studies, we showed that GRK5 is an important regulator of endotoxemia and polymicrobial sepsis pathogenesis (19,20). Although GRK5 is highly expressed in normal (9,21) and diseased (22) airways, its role in lung infection is unknown.…”

mentioning

confidence: 99%

“…To determine changes in the number of cells, cells were counted using a hemocytometer. For flow cytometry, cells were also labeled with cell surface markers for various immune cells (Gr-1, CD11b, F4/80, CD11c, B220, CD3, and Ly6C), and data were acquired using an LSR II flow cytometer (BD Biosciences) and were analyzed using FlowJo software (Tree Star, Inc., Ashland, OR, USA) as described previously (19).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Bacterial Dose-Dependent Role of G Protein-Coupled Receptor Kinase 5 in Escherichia coli-Induced Pneumonia

et al. 2016

Self Cite

View full text Add to dashboard Cite

c G protein-coupled receptor kinase 5 (GRK5) is a serine/threonine kinase previously shown to mediate polymicrobial sepsis-induced inflammation. The goal of the present study was to examine the role of GRK5 in monomicrobial pulmonary infection by using an intratracheal Escherichia coli infection model of pneumonia. We used sublethal and lethal doses of E. coli to examine the mechanistic differences between low-grade and high-grade inflammation induced by E. coli infection. With a sublethal dose of E. coli, GRK5 knockout (KO) mice exhibited higher plasma CXCL1/KC levels and enhanced lung neutrophil recruitment early after infection, and lower bacterial loads, than wild-type (WT) mice. The inflammatory response was also diminished, and resolution of inflammation advanced, in the lungs of GRK5 KO mice. In contrast to the reduced bacterial loads in GRK5 KO mice following a sublethal dose, at a lethal dose of E. coli, the bacterial burdens remained high in GRK5 KO mice relative to those in WT mice. This occurred in spite of enhanced plasma CXCL1 levels as well as neutrophil recruitment in the KO mice. But the recruited neutrophils (following high-dose infection) exhibited decreased CD11b expression and reduced reactive oxygen species production, suggesting decreased neutrophil activation or increased neutrophil exhaustion in the GRK5 KO mice. In agreement with the increased bacterial burden, KO mice showed poorer survival than WT mice following E. coli infection at a lethal dose. Overall, our data suggest that GRK5 negatively regulates CXCL1/KC levels during bacterial pneumonia but that the role of GRK5 in the clinical outcome in this model is dependent on the bacterial dose.

show abstract

Overexpression of interleukin‐10 in engineered macrophages protects endothelial cells against LPS‐induced injury in vitro

Weng

Nie

et al. 2022

FEBS Open Bio

View full text Add to dashboard Cite

Endothelial dysfunction is a primary pathophysiological change in sepsis. Macrophages are known to interact with vascular endothelial cells during the development of sepsis. Recently, drug delivery based on engineered macrophages was reported as an alternative approach for the management of diseases. Interleukin‐10 (IL10) is a well‐known anti‐inflammatory cytokine, which reduces inflammation and inhibits dysfunction of endothelial cells caused by sepsis. It is currently poorly understood whether genetically modified macrophages with overexpression of IL10 are able to restore endothelial integrity and function at the cellular level. In this study, we used lentiviral vectors to construct RAW264.7 macrophages engineered to overexpress IL10 (IL10‐eM) and investigated the effects of the IL10‐eM supernatant on LPS‐induced endothelial dysfunction using a noncontact coculture system. We found that cotreatment with IL10‐eM supernatant significantly attenuates the effects of LPS‐induced dysfunction of endothelial cells, including endothelial inflammatory response, endothelial permeability, and apoptosis. In addition, we discovered that LPS‐induced downregulation of VE‐cadherin and high production of reactive oxygen species were significantly attenuated upon IL10‐eM exposure. Furthermore, upregulation of IL6, TNFα, and Bax was decreased after treatment of cells with IL10‐eM supernatant. These results demonstrated that supernatant from engineered macrophages genetically modified with IL10 can effectively protect endothelial cells against LPS‐induced dysfunction in vitro, suggesting that exosomes from such engineered macrophages may have therapeutic effects against sepsis.

show abstract

G-Protein-Coupled Receptor Kinase-5 Mediates Inflammation but Does Not Regulate Cellular Infiltration or Bacterial Load in a Polymicrobial Sepsis Model in Mice

Cited by 30 publications

References 44 publications

Gene Dosage-Dependent Negative Regulatory Role of β-Arrestin-2 in Polymicrobial Infection-Induced Inflammation

Gene Dosage-Dependent Negative Regulatory Role of β-Arrestin-2 in Polymicrobial Infection-Induced Inflammation

Bacterial Dose-Dependent Role of G Protein-Coupled Receptor Kinase 5 in Escherichia coli-Induced Pneumonia

Overexpression of interleukin‐10 in engineered macrophages protects endothelial cells against LPS‐induced injury in vitro

Contact Info

Product

Resources

About