[22] δ1-pyrroline-5-carboxylate synthase from rat intestinal mucosa

Kramer, J. J.; Henslee, Jerry G.; Wakabayashi, Yasuo; Jones, Mary Ellen

doi:10.1016/s0076-6879(85)13025-9

Cited by 10 publications

(10 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The synthesis of P5C in animals, however, is not inhibited by L-proline but is sensitive to ornithine (12)(13)(14). In this regard, the plant enzyme is more similar to that in prokaryotes.…”

Section: P5csmentioning

confidence: 96%

“…Whereas proline can be synthesized from either glutamate or ornithine in plants (7,8) and animals (12)(13)(14), stable isotope and radioisotope labeling experiments (15)(16)(17) indicate that glutamate, rather than ornithine, is the primary precursor for proline biosynthesis in osmotically stressed plant cells. With the exception of P5CR, which has been recently characterized (18)(19)(20),j however, little is known about the other enzymes in this pathway.…”

mentioning

confidence: 99%

“…Northern GTGACCTCAAGGGAAGAGATCCCTGAGCTACTTAAGTTGGATGATGTAATTGATCTGGTAATTCCAAGAGGCAGTAACAAACTTGTTTCTCAGATCAAGAGTTCAACTAAAATTCCTGTT 1560 in animal systems since a P5CS activity has been detected in mammalian cells, although it is not known whether this is due to a single or to two separate enzymes (12)(13)(14).…”

mentioning

confidence: 99%

See 2 more Smart Citations

A bifunctional enzyme (delta 1-pyrroline-5-carboxylate synthetase) catalyzes the first two steps in proline biosynthesis in plants.

Delauney

Verma

1992

Proc. Natl. Acad. Sci. U.S.A.

470

339

View full text Add to dashboard Cite

A bifunctional enzyme catalyzes the first two steps in proline biosynthesis in plants (osogaton/ultrogen S The Vigna PSCS enzyme activity is feedback regulated by proline but is less sensitive to end-product inhibition than is the E. coil y-glutamyl kinase. The PSCS gene is exprsd at high levels in Vigna leaves and is Inducible in roots subjected to salt stres, suggeng that P5CS plays a key role in proline biosynthesis, leading to osmoregulation in plants.

show abstract

Section: P5csmentioning

confidence: 96%

mentioning

confidence: 99%

See 1 more Smart Citation

A bifunctional enzyme (delta 1-pyrroline-5-carboxylate synthetase) catalyzes the first two steps in proline biosynthesis in plants.

Delauney

Verma

1992

Proc. Natl. Acad. Sci. U.S.A.

470

339

View full text Add to dashboard Cite

show abstract

“…The activity is sensitive to inhibition by ornithine . And unlike the bacterial enzyme, the conversion of glutamate to P5C in mammalian tissues is not inhibited by proline (Kramer et al, 1985). Interestingly, in rat tissues the enzyme has been detected only in intestine and thymus .…”

Section: In Animalsmentioning

confidence: 92%

The proline biosynthesis in living organisms

Aral

Kamoun

1997

Amino Acids

View full text Add to dashboard Cite

Summary.In this article we review recent work on the physiology of proline and Al-pyrroline-5-carboxylate (P5C) in living organisms and consider recent progress in our understanding of the role of P5C synthetase in collagen metabolism and the regulation of urea cycle in vertebrates. Much of this recent progress has been made possible by advances in our knowledge of the enzymes and genes involved in proline biosynthesis in man. The availability of well characterized P5C synthetase deficiency in man has been an impetus for the cloning of the cDNA encoding for this enzyme from man and facilitated the establishment of the phenotype-genotype relationships in PSC synthetase deficiency in higher vertebrates.

show abstract

“…The synthesis of citrulline from glutamine involves 5 mitochondrial enzymes; phosphate-dependent glutaminase (PDG), pyrroline-5-carboxylate synthase (P5CS), ornithine aminotransferase (OAT), OCT and CPSI with P5CS being the key regulatory enzyme [104,[116][117][118] . P5CS is unique to small intestinal enterocytes [116,[119][120][121] .…”

Section: Pathways For Citrulline Synthesismentioning

confidence: 99%

Biomarkers for radiation-induced small bowel epithelial damage: An emerging role for plasma Citrulline

Lutgens¹,

Lambin²

2007

WJG

View full text Add to dashboard Cite

Reduction of cancer treatment-induced mucosal injury has been recognized as an important target for improving the therapeutic ratio as well as reducing the economic burden associated with these treatment related sequellae. Clinical studies addressing this issue are hampered by the fact that specific objective parameters, which enable monitoring of damage in routine clinical practice, are lacking. This review summarizes pros and cons of currently available endpoints for intestinal injury. The metabolic background and characteristics of plasma citrulline, a recently investigated biomarker specifically for small intestinal injury, are discussed in more detail.

show abstract

[22] δ1-pyrroline-5-carboxylate synthase from rat intestinal mucosa

Cited by 10 publications

References 36 publications

A bifunctional enzyme (delta 1-pyrroline-5-carboxylate synthetase) catalyzes the first two steps in proline biosynthesis in plants.

A bifunctional enzyme (delta 1-pyrroline-5-carboxylate synthetase) catalyzes the first two steps in proline biosynthesis in plants.

The proline biosynthesis in living organisms

Biomarkers for radiation-induced small bowel epithelial damage: An emerging role for plasma Citrulline

Contact Info

Product

Resources

About