2,5-Diketo-D-Gluconate Hyperproducing Gluconobacter sphaericus SJF2-1 with Reporting Multiple Genes Encoding the Membrane-Associated Flavoprotein-Cytochrome c Complexed Dehydrogenases

Abstract

Gluconobacter sphaericus has not yet been used in biotransformation studies. In this study, G. sphaericus SJF2-1, which produces a diffusible pigment, was isolated from grape. The spent culture medium became dark black when the cells were grown in medium containing glucose and then autoclaved. This bacterium produced 2,5-diketo-D-gluconate (2,5-DKG) from D-glucose and D-gluconate. When 5% D-glucose was used, the conversion efficiency was approximately 52.4% in a flask culture. 2,5-DKG is a precursor of 2-keto-L-gulonic acid, which is a key intermediate in the industrial production of L-ascorbic acid. The complete genome sequence of G. sphaericus SJF2-1 was determined for the first time in the G. sphaericus species. The total size was 3,198,086 bp, with 2867 protein-coding sequences; one chromosome and six plasmids were identified. From the genome of SJF2-1, multiple genes homologous to those involved in the conversion of D-glucose to 2,5-DKG were identified. In particular, six different genes encoding membrane-associated flavoprotein-cytochrome c complexed dehydrogenase were identified and divided into two different lineages. This study suggests the potential of G. sphaericus SJF2-1 to mass-produce 2,5-DKG and other D-glucose oxidation products.

Draft genome sequence of Methylobacterium sp. OT2 isolated from human skin and capable of growing on t -octylphenol polyethoxylate

“…Ethical approval for subject sampling was granted by the institutional review board of Changwon National University. Sanger sequencing of the 16S rRNA gene using primers 27F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 1492R (5′- GGTTACCTTGTTACGACTT -3′), along with BLASTN analysis ( 4 ), identified OT2 as a member of the genus Methylobacterium . It showed the highest similarity to M. oryzae CBMB20 T (99.63%) and M. fujisawaense strain DSM 5686 T (99.63%).…”

Continuous cropping of potato changed the metabolic pathway of root exudates to drive rhizosphere microflora

“…PPHP is a hydroperoxide, an initial product of lipid peroxidation (Weller et al, 1985), and lipid peroxidation is a major indicator of oxidative damage in plants (Chen et al, 2021;Fardus et al, 2021). 2,5-Diketo-dgluconate is a key intermediate in the production of l-ascorbic acid (vitamin C; Son et al, 2022), which is a main antioxidant in plants and plays important roles in alleviating excessive activities of oxidative free radicals caused by many abiotic stresses (Gallie, 2013). Exogenous application of 4-methylumbelliferone to Arabidopsis thaliana seeds before seedling formation could affect seed germination, resulting in reduced primary root growth, root hair formation, irregular root cap shedding, and reorganization of actin cytoskeleton in root tip (Li et al, 2011).…”

Genome Sequences of Metabacillus sp. Strain B2-18, Isolated from Human Skin, and Metabacillus endolithicus KCTC 33579 T

“…Sanger sequencing of the 16S rRNA gene amplicon with primers 27F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 1492R (5′- GGTTACCTTGTTACGACTT -3′) ( 3 ) yielded unidentifiable overlapping peaks with partially recognizable nucleotide sequences at the 5′ and 3′ ends. The amplification conditions were the same as those described previously ( 4 ). The resulting partial nucleotide sequences were used for homology analysis with the NCBI database and enabled the identification of B2-18 as belonging to the genus Metabacillus .…”