16S ribosomal DNA amplification for phylogenetic study

Weisburg, William G.; Barns, Susan M.; Pelletier, Dale A.; Lane, David

doi:10.1128/jb.173.2.697-703.1991

Cited by 9,861 publications

(5,940 citation statements)

References 21 publications

Supporting

Mentioning

5,788

Contrasting

Unclassified

101

Order By: Relevance

“…The ensuing supernatant contained the DNA crude extract (OD 260 /OD 230 > 1.7; OD 260 /OD 280 between 1.8 and 2.0). The 16S rRNA gene (~1500 bp) was then amplified using the forward primer 27F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and the reverse primer 1492R (5′‐GGTTACCTTGTTACGACTT‐3′) (Weisburg et al ., 1991), and then sequenced at BGI‐Shenzhen (BGI, Shenzhen, Guang dong, China). The sequences obtained were assembled, analysed, and manually edited with a CAP3 software package.…”

Section: Methodsmentioning

confidence: 99%

Antibiofilm activity substances derived from coral symbiotic bacterial extract inhibit biofouling by the model strain Pseudomonas aeruginosa PAO1

Song

Cai

Lao

et al. 2018

Microbial Biotechnology

View full text Add to dashboard Cite

SummaryThe mitigation of biofouling has received significant research attention, with particular focus on non‐toxic and sustainable strategies. Here, we investigated quorum sensing inhibitor (QSI) bacteria as a means of controlling biofouling in a laboratory‐scale system. Approximately, 200 strains were isolated from coral (Pocillopora damicornis) and screened for their ability to inhibit quorum sensing (QS). Approximately, 15% of the isolates exhibited QSI activity, and a typical coral symbiotic bacterium, H12‐Vibrio alginolyticus, was selected in order for us to investigate quorum sensing inhibitory activity further. Confocal microscopy revealed that V. alginolyticus extract inhibited biofilm formation from Pseudomonas aeruginosa PAO1. In addition, the secondary metabolites of V. alginolyticus inhibited PAO1 virulence phenotypes by downregulating motility ability, elastase activity and rhamnolipid production. NMR and MS spectrometry suggested that the potential bioactive compound involved was rhodamine isothiocyanate. Quantitative real‐time PCR indicated that the bacterial extract induced a significant downregulation of QS regulatory genes (lasB, lasI, lasR, rhlI, rhlR) and virulence‐related genes (pqsA, pqsR). The possible mechanism underlying the action of rhodamine isothiocyanate analogue involves the disruption of the las and/or rhl system of PAO1. Our results highlight coral microbes as a bioresource pool for developing QS inhibitors and identifying novel antifouling agents.

show abstract

Section: Methodsmentioning

confidence: 99%

Antibiofilm activity substances derived from coral symbiotic bacterial extract inhibit biofouling by the model strain Pseudomonas aeruginosa PAO1

Song

Cai

Lao

et al. 2018

Microbial Biotechnology

View full text Add to dashboard Cite

show abstract

“…Taxonomic groups within the Bacteria and Archaea domains were identified using amplicon sequencing targeting the 16S rRNA gene (Weisburg et al., 1991). The standard 341F/785R primers (Klindworth et al., 2013) were used for the broadest coverage of guano microbiota, and amplicons were sequenced using 2 × 300 base reads on an Illumina MiSeq (Weisburg et al., 1991).…”

Section: Methodsmentioning

confidence: 99%

“…The standard 341F/785R primers (Klindworth et al., 2013) were used for the broadest coverage of guano microbiota, and amplicons were sequenced using 2 × 300 base reads on an Illumina MiSeq (Weisburg et al., 1991). Two runs were used to generate sequence data, and no statistically significant run effects were detected.…”

Section: Methodsmentioning

confidence: 99%

Guano exposed: Impact of aerobic conditions on bat fecal microbiota

Fofanov

Furstenau

Sanchez

et al. 2018

Ecology and Evolution

View full text Add to dashboard Cite

Bats and their associated guano microbiota provide important terrestrial and subterranean ecosystem services and serve as a reservoir for a wide range of epizootic and zoonotic diseases. Unfortunately, large‐scale studies of bats and their guano microbiotas are limited by the time and cost of sample collection, which requires specially trained individuals to work at night to capture bats when they are most active. Indirectly surveying bat gut microbiota through guano deposits could be a more cost‐effective alternative, but it must first be established whether the postdefecation exposure to an aerobic environment has a large impact on the guano microbial community. A number of recent studies on mammalian feces have shown that the impact of aerobic exposure is highly species specific; therefore, it is difficult to predict how exposure will affect the bat guano microbiota without empirical data. In our study, we collected fresh guano samples from 24 individuals of 10 bat species that are common throughout the arid environments of the American southwest and subjected the samples to 0, 1, and 12 hr of exposure. The biodiversity decreased rapidly after the shift from an anaerobic to an aerobic environment—much faster than previously reported in mammalian species. However, the relative composition of the core guano microbiota remained stable and, using highly sensitive targeted PCR methods, we found that pathogens present in the original, non‐exposed samples could still be recovered after 12 hr of exposure. These results suggest that with careful sample analysis protocols, a more efficient passive collection strategy is feasible; for example, guano could be collected on tarps placed near the roost entrance. Such passive collection methods would greatly reduce the cost of sample collection by allowing more sites or roosts to be surveyed with a fraction of trained personnel, time, and effort investments needed.

show abstract

“…rRNA genes were amplified by polymerase chain reaction (PCR) from corresponding DNA extracts using bacterial primers 8F and 1492 [78] and cloned using a TOPO TA Cloning® Kit for Sequencing (Invitrogen, Carlsbad, CA). One hundred colonies from each sample were analyzed with restriction endonuclease Msp1 (Promega, Madison, WI) to identify unique operational taxonomical units (OTUs).…”

Section: Microbial Community Analysesmentioning

confidence: 99%

Influence of Petroleum Deposit Geometry on Local Gradient of Electron Acceptors and Microbial Catabolic Potential

Singh

Pruden

Widdowson

2012

Environ. Sci. Technol.

View full text Add to dashboard Cite

A field survey was conducted following the Deepwater Horizon blowout and it was noted that resulting coastal petroleum deposits possessed distinct geometries, ranging from small tar balls to expansive horizontal oil sheets. A laboratory study evaluated the effect of oil deposit geometry on localized gradients of electron acceptors and microbial community composition, factors that are critical to accurately estimating biodegradation rates. One-dimensional top-flow sand columns with 12-hour simulated tidal cycles compared two contrasting geometries (isolated tar "balls" versus horizontal "sheets") relative to an oil-free control. Significant differences in the effluent dissolved oxygen and sulfate concentrations were noted among the columns, indicating presence of anaerobic zones in the oiled columns, particularly in the sheet condition. iv

show abstract

16S ribosomal DNA amplification for phylogenetic study

Cited by 9,861 publications

References 21 publications

Antibiofilm activity substances derived from coral symbiotic bacterial extract inhibit biofouling by the model strain Pseudomonas aeruginosa PAO1

Antibiofilm activity substances derived from coral symbiotic bacterial extract inhibit biofouling by the model strain Pseudomonas aeruginosa PAO1

Guano exposed: Impact of aerobic conditions on bat fecal microbiota

Influence of Petroleum Deposit Geometry on Local Gradient of Electron Acceptors and Microbial Catabolic Potential

Contact Info

Product

Resources

About