Fungos isolados da água de consumo de uma comunidade ribeirinha do médio Rio Solimões, Amazonas-Brasil: potencial patogênico

Abstract

RESUMOOs fungos passaram a receber maior atenção como contaminantes de água potável, devido algumas doenças estarem relacionadas a esses microrganismos e ao abastecimento inadequado, principalmente em populações ribeirinhas. Este trabalho verificou a presença de fungos na água de consumo da comunidade ribeirinha, Lago do Limão, Iranduba -AM, e avaliou o perfil de patogenicidade dos fungos isolados. As espécies fúngicas isoladas foram identificadas fenotipicamente e geneticamente. A avaliação dos fungos, quanto ao seu potencial de patogenicidade, incluiu: Crescimento a 37°C, Produção de Ureases e Proteases. Como resultados, foram isoladas 101 culturas de diferentes gêneros da subdivisão Deuteromycotina. Os gêneros isolados de maior frequência foram Aspergillus spp (41,6%), Penicillium spp (19,8%) e Trichoderma spp. (27,7%). Quanto aos parâmetros de patogenicidade, verificou-se que 95% das amostras apresentaram positividade quando incubadas a 37ºC; 66,3% em meio Ágar Christensen e 58,4% no teste de Proteases. Há escassez de trabalhos que abordam a patogenicidade dos fungos presentes na água, principalmente, em água consumida pelas comunidades ribeirinhas. Espera-se que os resultados deste trabalho possam subsidiar a legislação brasileira estabelecer limites de fungos presentes em água potável. Palavras-chave: avaliação, patogenicidade, saúde.A isolated fungi in water consumed by riverside community of the middle Rio Solimões, Amazonas, Brazil: pathogenic potential ABSTRACTFungi have received increased attention as drinking water contaminants, because some diseases are related to these microorganisms and inadequate supply, especially in the coastal communities. This study verified the presence of fungi in the water consumed by the riverside community of Lake Lemon, Iranduba, AM and assessed the pathogenicity of isolated fungi. The isolated fungal species were identified phenotypically and genetically. Evaluation of the pathogenic potential of the fungi included: growth at 37°C, and the production of urease and proteases. As a result, 101 cultures of different genera belonging to the Deuteromycotina

Fungi Isolated from Wild Birds and Litter in the Itatiaia National Park in Southeastern Brazil

“…However, with the methodology used by the authors, it was not possible to identify the genera and morphospecies present in the samples. The most modern molecular biology techniques should complement the basic techniques of cultivation and identification, in order to identify specifically through the sequencing of nuclear genes, such as the ITS gene, which is the main gene used for molecular identification and phylogeny (Lima et al, 2017).…”

Fungi isolated from wild birds in the Marambaia Island, Rio de Janeiro State, southeastern Brazil

“…This reagent mixture was subjected to amplification with a temperature profile that consisted of an initial denaturation step at 94°C for 5 minutes, followed by 35 cycles with denaturation at 94°C for 30 seconds, annealing at 60°C for 1 minute, and extension at 72°C for 2 minutes. At the end of the 35 cycles, a final extension was performed at 72°C for 10 minutes (Lima et al 2017). The primers used for amplification were ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3') (White et al 1990).…”

“…The most modern techniques of molecular biology should complement (and not replace) the basic techniques of cultivation and identification to avoid identification errors, using morphological taxonomic keys and sequencing of nuclear genes, such as the ITS gene, which is the main gene used for molecular identification and phylogeny (Lima et al 2017). Studies conducted by Labrador et al ( 2021) verified the prevalence of Kingdom Fungi in relation to other microorganisms in the feathers of birds from southern Spain, showing fungi as the main microorganisms.…”

Antimicrobial Potential of Extracts from <em>Penicillium purpurogenum</em> Isolated from Aquatic Environment in the Amazon and Identification of Citrinin Derivatives

“…The strain of P. purpurogenum (CFAM -214) was provided by the Collection of Fungi from the Amazon (CFAM) at the Oswaldo Cruz Foundation -Leônidas and Maria Deane Institute (ILMD/Fiocruz Amazônia), originating from the same Amazonian environment as other strains, as described in a previous study [23].…”