Analysis of the presence of FLT3 gene mutation and association with prognostic factors in adult and pediatric acute leukemia patients

Burnatt, Graciele; Licínio, Marley Aparecida; Gaspar, Pâmela Cristina; Ferreira, Arthur Schveitzer; Reis, Marlon M.; Moraes, Ana Carolina Rabello de; Sincero, Thaís Cristine Marques; Santos-Silva, Maria Cláudia

doi:10.1590/s2175-97902017000216105

Cited by 7 publications

(5 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…FLT3-ITD was significantly more prevalent among APL compared with non-APL patients, consistent with three other studies that reported prevalences between 35% and 37% among APL patients (35)(36)(37). The prevalence of FLT3-ITD among all AML patients has been found to range from 16% to 25%, and our results fall within this range (37)(38)(39). FLT3-ITD has been established as a poor prognostic factor among all AML patients (40,41).…”

Section: Discussionsupporting

confidence: 92%

Comparing the epidemiology, clinical characteristics and prognostic factors of acute myeloid leukemia with and without acute promyelocytic leukemia

et al. 2019

View full text Add to dashboard Cite

Acute promyelocytic leukemia (APL) is a particularly aggressive subtype of acute myeloid leukemia (AML), with high rates of early death. It is important to examine how epidemiological characteristics, clinical and treatment factors, cytogenetic and genetic data affect survival and differ between APL and non-APL AML patients. We analyzed population data from the New York State Cancer Registry to characterize AML including APL incidence rates by demographics. APL incidence rates were higher among Hispanics than non-Hispanics [incidence rate ratio = 1.22; 95% confidence interval (CI) = 1.02–1.43]; and among foreign-born than USA-born persons. APL incidence rates increased more rapidly through 1995–2014 than non-APL AML; and its frequency increased faster among foreign-born persons. In a hospital cohort of 390 AML patients, the risk of death was significantly higher among APL patients with FLT3-internal tandem duplications than those without [hazard ratio (HR) = 11.74; 95% CI = 1.03–134.5]; and among APL patients with secondary versus de novo disease (HR = 17.32; 95% CI = 1.56–192.1). Among non-APL AML patients, risk of death was significantly associated with prior chemotherapy with antitubulin agents after adjusting for age, gender and ethnicity (adjusted HR = 3.30; 95% CI = 1.49–7.32); and separately with older age, unfavorable cytogenetics and complex karyotype. This study highlights FLT3-internal tandem duplications as a prognostic factor in APL and proposes consideration of prior antitubulin therapy as a prognostic factor in non-APL AML.

show abstract

Section: Discussionsupporting

confidence: 92%

Comparing the epidemiology, clinical characteristics and prognostic factors of acute myeloid leukemia with and without acute promyelocytic leukemia

et al. 2019

View full text Add to dashboard Cite

show abstract

“…FLT3 gene mutations are found in 25 to 45% among AML patients and FLT3-ITD mutations are found in approximately 20 to 37% (Auewarakul et al, 2005;Burnatt et al, 2017). FLT3-D835 mutations are found to be less common as compared to FLT3-ITD mutations with the percentage of 5.8 to 7.7%.…”

Section: Discussionmentioning

confidence: 97%

Identification of FLT3 and NPM1 Mutations in Patients with Acute Myeloid Leukaemia

Yusoff

Seman

Othman

et al. 2019

Asian Pac J Cancer Prev

View full text Add to dashboard Cite

Objective:The most frequent acquired molecular abnormalities and important prognostic indicators in patients with Acute Myeloid Leukaemia (AML) are fms-like tyrosine kinase-3 gene (FLT3) and nucleophosmin-1 (NPM1) mutations. Our study aims to develop a cost effective and comprehensive in-house conventional PCR method for detection of FLT3-ITD, FLT3-D835 and NPM1 mutations and to evaluate the frequency of these mutations in patients with cytogenetically normal (CN) AML in our population. Methods: A total of 199 samples from AML patients (95 women, 104 men) were included in the study. Mutation analyses were performed using polymerase chain reaction (PCR) and gene sequencing. Result: Sixty-eight patients were positive for the mutations. FLT3-ITD mutations were detected in 32 patients (16.1%), followed by FLT3-D835 in 5 (2.5%) and NPM1 in 54 (27.1%). Double mutations of NPM1 and FLT3-ITD were detected in 23 cases (11.6%). Assays validation were performed using Sanger sequencing and showed 100% concordance with in house method. Conclusion: The optimized in-house PCR assays for the detection of FLT3-ITD, FLT3-D835 and NPM1 mutations in AML patients were robust, less labour intensive and cost effective. These assays can be used as diagnostic tools for mutation detection in AML patients since identification of these mutations are important for prognostication and optimization of patient care.

show abstract

“…The allele-specific polymerase chain reaction (ASPCR) was performed for the detection of ITD in the FLT3 gene with the help of previously reported primers i.e. F-14:5′- CTAACTGACTCATCATTTCATCTCTGA -3′ and R-155′- AAACATTTGGCACATTCCATTC -3′ ( Burnatt et al, 2017 ). The GAPDH gene was used to make sure the equal loading of the sample by using the previously reported primers F: 5ˊ-ACCACAGTCCATGCCATCA-3ˊ and R: 5ˊ-TCCACCACCCTGTTGCTGTA-3ˊ ( Asad et al, 2012 ).…”

Section: Methodsmentioning

confidence: 99%

RUNX1 mutation and elevated FLT3 gene expression cooperates to induce inferior prognosis in cytogenetically normal acute myeloid leukemia patients

Rehman

Akram

Chaudhary

et al. 2021

Saudi Journal of Biological Sciences

View full text Add to dashboard Cite

Background Acute myeloid leukemia (AML) is a bone marrow malignancy having multiple molecular pathways driving its progress. In recent years, the main causes of AML considered all over the world are genetic variations in cancerous cells. The RUNX1 and FLT3 genes are necessary for the normal hematopoiesis and differentiation process of hematopoietic stem cells into mature blood cells, therefore they are the most common targets for point mutations resulting in AML. Methods We screened 32 CN-AML patients for FLT3-ITD (by Allele-specific PCR) and RUNX1 mutations (by Sanger sequencing). The FLT3 mRNA expression was assessed in all AML patients and its subgroups. Results Eight patients (25%) carried RUNX1 mutation (K83E) while three patients (9.37%) were found to have internal tandem duplications in FLT3 gene. The RUNX1 mutation data were correlated with clinical parameters and FLT3 gene expression profile. The RUNX1 mutations were observed to be significantly prevalent in older males. Moreover, RUNX1 and FLT3-mutated patients had lower complete remission rate, event-free survival rate, and lower overall survival rate than patients with wild-type RUNX1 and FLT3 gene. The RUNX1 and FLT3 mutant patients with up-regulated FLT3 gene expression showed even worse prognosis. Bradford Assay showed that protein concentration was down-regulated in RUNX1 and FLT3 mutants in comparison to RUNX1 and FLT3 wild-type groups. Conclusion This study constitutes the first report from Pakistan reporting significant molecular mutation analysis of RUNX1 and FLT3 genes including FLT3 expression evaluation with follow-up. This provides an insight that aforementioned mutations are markers of poor prognosis but the study with a large AML cohort will be useful to further investigate their role in disease biology of AML.

show abstract

Analysis of the presence of FLT3 gene mutation and association with prognostic factors in adult and pediatric acute leukemia patients

Cited by 7 publications

References 41 publications

Comparing the epidemiology, clinical characteristics and prognostic factors of acute myeloid leukemia with and without acute promyelocytic leukemia

Comparing the epidemiology, clinical characteristics and prognostic factors of acute myeloid leukemia with and without acute promyelocytic leukemia

Identification of FLT3 and NPM1 Mutations in Patients with Acute Myeloid Leukaemia

RUNX1 mutation and elevated FLT3 gene expression cooperates to induce inferior prognosis in cytogenetically normal acute myeloid leukemia patients

Contact Info

Product

Resources

About