Population analysis of Scomberomorus cavalla (Cuvier, 1829) (Perciformes, Scombridae) from the Northern and Northeastern coast of Brazil

El, Santa Brígida; Db, Cunha; Rêgo, Péricles Sena do; Sampaio, Iracilda; Schneider, Horácio; Vallinoto, Marcelo

doi:10.1590/s1519-69842007000500016

Cited by 19 publications

(17 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The estimated levels of genetic variation are consistent with large populations and are quite similar to that of the congeneric species S. sierra ( h = 0·997, π = 0·019) and Scomberomorus maculatus (Mitchill 1815) ( h = 0·812, π = 0·026) for sequences of the mtDNA‐CR and nicotinamide adenine dinucleotide (NADH), respectively (Buonaccorsi et al , ; Domínguez‐López et al , ); however, the estimated variation was higher than that reported in the mtDNA‐CR of S. cavalla ( h = 0·704, π = 0·005; Santa Brígida et al , ).…”

Section: Scomberomorus Concolor Sample Locations Summary Statistics supporting

confidence: 67%

Post‐glacial population expansion of the Monterey Spanish mackerel Scomberomorus concolor in the Gulf of California

Domínguez-López

Díaz‐Jaimes

Uribe‐Alcocer

et al. 2015

Journal of Fish Biology

View full text Add to dashboard Cite

The level of genetic homogeneity and demographic history of the Monterey Spanish mackerel Scomberomorus concolor was assessed by analyses using sequences of the mitochondrial (mt)DNA-control region of samples from the two oceanographic regions of the Gulf of California in order to define the stock structure for this exploited vulnerable species. The data were consistent with a single homogeneous population and revealed the hallmark of fluctuations in population size; these fluctuations appear to have occurred during glacial events of the middle to late Pleistocene, which may in turn be related to the colonization and expansion of S. concolor populations in the gulf.

show abstract

Section: Scomberomorus Concolor Sample Locations Summary Statistics supporting

confidence: 67%

Post‐glacial population expansion of the Monterey Spanish mackerel Scomberomorus concolor in the Gulf of California

Domínguez-López

Díaz‐Jaimes

Uribe‐Alcocer

et al. 2015

Journal of Fish Biology

View full text Add to dashboard Cite

show abstract

“…The mitochondrial Control Region was amplified using the primers L1 (5′‐CCTAACTCCCAAAGCTAGGTATTC‐3′) and H2 (5′‐ TGTTTATCACTGCTGRRTTCCCT‐3′), described by Santa Brígida et al. (). The PCRs were prepared in a final volume of 25 μl containing: 2.5 μl Buffer (20 mM Tris‐HCl), 4 μl of dNTPs (1.25 mM), 1 μl of MgCl 2 (50 mM), 1–1.5 μl of DNA (approximately 50 ng), 0.25 μl (200 ng/μl) of each primer, 0.2 μl of 1 U Taq polymerase (5 U/μl, Invitrogen, Carlsbad, USA), with water being added to complete the final reaction volume.…”

Section: Methodsmentioning

confidence: 99%

Loss of genetic variability in the captive stocks of tambaqui,Colossoma macropomum(Cuvier, 1818), at breeding centres in Brazil, and their divergence from wild populations

et al. 2018

View full text Add to dashboard Cite

The loss of variability in farmed populations and the risks of interactions with wild populations support the need for the genetic monitoring of species farmed throughout the world. In Brazil, the tambaqui is the most widely farmed native fish species. Despite this, there are no data on the pedigree of the farmed stocks, and the potential for interactions with wild populations in the Amazon basin has raised concerns with regard to the genetic variability of these stocks. The present study analysed sequences of the mitochondrial Control Region and 12 microsatellites to characterize the genetic variability of seven historically important commercial tambaqui breeding centres located in four different regions of Brazil, and compared these sequences with those obtained from individuals collected from a wild population. High levels of genetic diversity were found in the wild population, whereas genetic diversity was reduced in both markers in most captive populations, except for the broodstock located near the Amazon River. High FST and DEST indices were recorded between the wild population and most of the captive stocks analysed. The drastic reduction in genetic diversity found in most captive stocks and the difference between these stocks and the wild population may have been the result of the small size of the founding populations and the absence of breeding management. The renewal of the broodstocks and the application of breeding management techniques are recommended. In the Amazon region, in addition, the use of broodstocks that are genetically very different from local wild populations should be avoided.

show abstract

“…The mitochondrial Control Region was isolated and amplified using the Polymerase Chain Reaction (PCR) based on the primers D-LoopL1 '5 CTAACTCCCAAAGCTAGGTATTC3' and D-LoopH1 '5 TGTTTATCACTGCTGRRTTCCCT 3' (Santa Brígida et al, 2007). The PCR was run in a final volume of 25 µl composed of 4 μl of DNTPs (1.25 M), 2.5 μl of buffer solution (10X), 0.5 μl of MgCl 2 solution (50 mM), 1 μl of DNA (250 ng/μl), 0.25 μl of each primer (200 ng/μl), 0.2 μl of the Taq polymerase enzyme (5U/μl), and 16.3 μl of purified water.…”

Section: Pcr and Sequencingmentioning

confidence: 99%

Genetic differentiation in the populations of red piranha, Pygocentrus nattereri Kner (1860) (Characiformes: Serrasalminae), from the river basins of northeastern Brazil

et al. 2015

Self Cite

View full text Add to dashboard Cite

The red piranha, Pygocentrus nattereri, is an important resource for artisanal and commercial fisheries. The present study determines the genetic differentiation among P. nattereri populations from the northeastern Brazilian state of Maranhão. The DNA was isolated using a standard phenol-chloroform protocol and the Control Region was amplified by PCR. The PCR products were sequenced using the didesoxyterminal method. A sequence of 1039 bps was obtained from the Control Region of 60 specimens, which presented 33 polymorphic sites, 41 haplotypes, һ =0.978 and π =0.009. The neutrality tests (D and Fs) were significant (P < 0.05) for most of the populations analyzed. The AMOVA indicated that most of the molecular variation (72%) arises between groups. The fixation index was highly significant (F ST = 0.707, P < 0.00001). The phylogenetic analyses indicated that the specimens represented a monophyletic group. Genetic distances between populations varied from 0.8% to 1.9%, and were <0.5% within populations. The degree of genetic differentiation found among the stocks of P. nattereri indicates the need for the development of independent management plans for the different river basins in order to preserve the genetic variability of their populations. Keywords

show abstract

Population analysis of Scomberomorus cavalla (Cuvier, 1829) (Perciformes, Scombridae) from the Northern and Northeastern coast of Brazil

Cited by 19 publications

References 19 publications

Post‐glacial population expansion of the Monterey Spanish mackerel Scomberomorus concolor in the Gulf of California

Post‐glacial population expansion of the Monterey Spanish mackerel Scomberomorus concolor in the Gulf of California

Loss of genetic variability in the captive stocks of tambaqui,Colossoma macropomum(Cuvier, 1818), at breeding centres in Brazil, and their divergence from wild populations

Genetic differentiation in the populations of red piranha, Pygocentrus nattereri Kner (1860) (Characiformes: Serrasalminae), from the river basins of northeastern Brazil

Contact Info

Product

Resources

About