Genetic variability of Five Periplaneta americana L. (Dyctioptera: Blattidae) populations in southwestern Colombia using the AFLP molecular marker technique

Jaramillo, Gloria Isabel; Cárdenas, Héiber; Obando, Ranulfo González; Rosero-Galindo, Carol Yovanna

doi:10.1590/s1519-566x2010000300010

Cited by 8 publications

(5 citation statements)

References 24 publications

(23 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Population genetic structure and genetic diversity can provide important biological information for the study of invasive species (Wongsa, Duangphakdee, & Rattanawannee, ). However, there are limited studies on the population genetic structure of cockroaches (Cloarec, Rivault, & Cariou, ; Jaramillo‐Ramirez, Cárdenas‐Henao, González‐Obando, & Rosero‐Galindo, ; Vargo et al, ). Intraspecific phylogeny and haplotype networks all indicated the presence of very little genetic structure in P. americana (Figures and ).…”

Section: Discussionmentioning

confidence: 99%

Population genetic structure and intraspecific genetic distance of Periplaneta americana (Blattodea: Blattidae) based on mitochondrial and nuclear DNA markers

Liu

Shen³

et al. 2019

Ecology and Evolution

View full text Add to dashboard Cite

The American cockroach (Periplaneta americana) is a globally invasive pest that can cause significant economic loss and threaten human health. Although it is abundant and lives in close proximity to humans, few studies have investigated the genetic diversity of P. americana. Our study analyzed 1,053 P. americana and other Periplaneta species' samples from different locations in China and the United States. A traditional tree‐based method using 17 unique mitochondrial COI haplotypes of P. americana and 20 haplotypes of the other Periplaneta species accurately identified P. americana with a barcoding threshold of 5.1%. To identify the population genetic structure of P. americana, we investigated wingless gene and pooled them with obtained mtDNA data for a combined analysis. Although the genetic diversity of the USA group was relatively higher than the China group, the number of haplotypes and alleles of both groups was small. The analysis of molecular variance (AMOVA), intraspecific phylogeny, and haplotype networks indicated that P. americana had very little global genetic differentiation. The weak geographic genetic structure might reflect the human‐mediated dispersal of P. americana. Despite no apparent phylogeographic assignment of mtDNA and nuclear lineages was observed in both BI trees, the integrated COI sequence data identified four distinct P. americana haplotype groups, showing four ancient maternal lineages of P. americana in China and the United States.

show abstract

Section: Discussionmentioning

confidence: 99%

Population genetic structure and intraspecific genetic distance of Periplaneta americana (Blattodea: Blattidae) based on mitochondrial and nuclear DNA markers

Liu

Shen³

et al. 2019

Ecology and Evolution

View full text Add to dashboard Cite

show abstract

“…The American cockroach Periplaneta americana (Linnaeus) is a synanthropic pest that generally inhabits cosmopolitan to urban areas. Cockroaches survive in warm weather with high moisture conditions as well as in unfavorable environments for humans (i.e., sewers and other human-made habitats) [ 2 ]. Accordingly, cockroaches physically transmit several human pathogens and allergens from the environment to human habitations [ 3 ].…”

Section: Introductionmentioning

confidence: 99%

De Novo Transcriptome Analysis and Detection of Antimicrobial Peptides of the American Cockroach Periplaneta americana (Linnaeus)

et al. 2016

View full text Add to dashboard Cite

Cockroaches are surrogate hosts for microbes that cause many human diseases. In spite of their generally destructive nature, cockroaches have recently been found to harbor potentially beneficial and medically useful substances such as drugs and allergens. However, genomic information for the American cockroach (Periplaneta americana) is currently unavailable; therefore, transcriptome and gene expression profiling is needed as an important resource to better understand the fundamental biological mechanisms of this species, which would be particularly useful for the selection of novel antimicrobial peptides. Thus, we performed de novo transcriptome analysis of P. americana that were or were not immunized with Escherichia coli. Using an Illumina HiSeq sequencer, we generated a total of 9.5 Gb of sequences, which were assembled into 85,984 contigs and functionally annotated using Basic Local Alignment Search Tool (BLAST), Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) database terms. Finally, using an in silico antimicrobial peptide prediction method, 86 antimicrobial peptide candidates were predicted from the transcriptome, and 21 of these peptides were experimentally validated for their antimicrobial activity against yeast and gram positive and -negative bacteria by a radial diffusion assay. Notably, 11 peptides showed strong antimicrobial activities against these organisms and displayed little or no cytotoxic effects in the hemolysis and cell viability assay. This work provides prerequisite baseline data for the identification and development of novel antimicrobial peptides, which is expected to provide a better understanding of the phenomenon of innate immunity in similar species.

show abstract

“…Periplaneta genus has around 53 species, which are members of the Blattidae family [2]. Generally, it can survive in moist and filthy environments, including sewers (3). Moreover, it is one of the largest insect species [4], measuring on average 4 cm in length [5].…”

Section: Introductionmentioning

confidence: 99%

Molecular Identification of the American Cockroach (Periplaneta americana) in the Kurdistan Region of Iraq (Dictyoptera: Blattidae)

Ahmed,

Al-Muffti

2025

Egyptian Journal of Veterinary Sciences

View full text Add to dashboard Cite

C OCKROACHES, considered one of the oldest and most winged insects, are a common urban pest, mostly found in tropical regions. Periplaneta americana, a globally invasive pest, poses economic and health risks due to its common closeness to humans. The morphological identification of Periplaneta species is challenging due to their similarities, so the present work is designed to identify P. americana molecularly by mitochondrial cytochrome c oxidase subunit I (MT-COI) extraction technique, which supports morphological taxonomies. From May 2021 to mid-July 2023, 377 specimens were collected from 18 localities in four Kurdistan Region-Iraq governorates (Duhok, Erbil, Sulaymaniyah, and Halabja). Individual MT-COI extraction was performed on 28 specimens after morphological identification, then amplified with primers SHam-IS-F (CTGTTCCGGCACCTCTTTCT) and SHam-IS-R (CGGGCAACCAGGTTCACTAA) through polymerase chain reaction (PCR), and its products were visualized on a 1.5% agarose gel electrophoresis, then sequenced by Korea's Macrogen Co. After sequencing, Basic Local Alignment Searching Tools (BLAST) were used to compare the sequences to GenBank homologs. Finally, MEGA11 was used to evaluate the evolutionary relationships of the specimens and closely related species. The PCR method amplified 250 bp of the MT-COI gene, and the phylogenetic research and BLAST findings showed the cockroach CO1 gene resembled P. americana. The sequencing results were submitted to GenBank and identified under the following accession numbers for the first time in the Kurdistan Region,

show abstract

Genetic variability of Five Periplaneta americana L. (Dyctioptera: Blattidae) populations in southwestern Colombia using the AFLP molecular marker technique

Cited by 8 publications

References 24 publications

Population genetic structure and intraspecific genetic distance of Periplaneta americana (Blattodea: Blattidae) based on mitochondrial and nuclear DNA markers

Population genetic structure and intraspecific genetic distance of Periplaneta americana (Blattodea: Blattidae) based on mitochondrial and nuclear DNA markers

De Novo Transcriptome Analysis and Detection of Antimicrobial Peptides of the American Cockroach Periplaneta americana (Linnaeus)

Molecular Identification of the American Cockroach (Periplaneta americana) in the Kurdistan Region of Iraq (Dictyoptera: Blattidae)

Contact Info

Product

Resources

About