Plant or fungal sequences? An alternative optimized PCR protocol to avoid ITS (nrDNA) misamplification

Miranda, Vitor F. O.; Martins, Vanderlei Geraldo; Furlan, Antonio; Bacci, Maurício

doi:10.1590/s1516-89132010000100018

Cited by 13 publications

(14 citation statements)

References 34 publications

(36 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…It is worth noting that, probably due to their relatively low GC content, plastid loci such as trnL 20,22,40 (≈35% GC content), rbcL 26,40 (≈42% GC content), matK (≈35% GC content) or trnT 23,48 (≈25% GC content) may provide a better estimation of pollen number than nuclear markers (ITS1 and ITS2 ≈ 60% GC content). However, the drawbacks of ITS could to some extent be alleviated 49 by using high-fidelity DNA polymerases such Phusion High-Fidelity DNA polymerase 25,40 or Herculase II Fusion DNA polymerase (the present study), 3% (our study) or 5% DMSO 50 and by applying low primer annealing temperatures 45 . The detrimental impact of the accumulation of polymerase inhibitors could be reduced by increasing the number of PCR steps (3 to 5 successive PCRs) and by diluting a subsample of the previously obtained amplicons in fresh reagent mixtures at each step 45 .…”

Section: Efficiency Of Microscopy Vs Flow Cytometry In Counting Pollementioning

confidence: 84%

“…After reviewing the PCR protocol from Pornon et al 20 and optimizing the annealing temperatures at 55 °C and 50 °C for trnL and ITS1 respectively, the PCR programs were: 2 min denaturation at 95 °C; followed by 25, 30 or 35 cycles (20 s denaturation at 95 °C, 20 s annealing at 55 °C (50 °C for ITS1), 30 s elongation at 72 °C) and a final elongation at 72°C for 3 min. For ITS1, 3% DMSO was added in the reaction solution to increase Taq polymerase specificity 50 . PCRs were performed in the Thermal Cycler GeneAmp PCR System 9700 (Applied Biosystems) and each PCR product was visualized on 1% agarose in TAE 0.5X buffer and quantified on the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Experimental quantification of pollen with DNA metabarcoding using ITS1 and trnL

Baksay

Pornon

Burrus

et al. 2020

Sci Rep

View full text Add to dashboard Cite

Although the use of metabarcoding to identify taxa in DNA mixtures is widely approved, its reliability in quantifying taxon abundance is still the subject of debate. In this study we investigated the relationships between the amount of pollen grains in mock solutions and the abundance of highthroughput sequence reads and how the relationship was affected by the pollen counting methodology, the number of PCR cycles, the type of markers and plant species whose pollen grains have different characteristics. We found a significant positive relationship between the number of DNA sequences and the number of pollen grains in the mock solutions. However, better relationships were obtained with light microscopy as a pollen grain counting method compared with flow cytometry, with the chloroplastic trnL marker compared with ribosomal ITS1 and with 30 when compared with 25 or 35 PCR cycles. We provide a list of recommendations to improve pollen quantification. Environmental DNA metabarcoding is a molecular method that consists of investigating environmental DNA samples made of complex mixtures of genomes from numerous organisms 1. Due to new sequencing technologies and bioinformatics tools, metabarcoding has been increasingly used to identify taxa in environmental samples 1 to monitor biodiversity 2-4 , to investigate ecosystem functioning 5 and interaction networks 6-8 , in both aquatic and terrestrial ecosystems. Nevertheless, its reliability in quantitative approaches, which depend on the match between counts of high-throughput sequence reads and the amount of sampled biological material 2 , is still the subject of debate 9,10. While taxon identification can reveal individual diet breadth 11 , species richness, and the composition of habitats 2 , communities 12 and ecological networks 4 , taxon quantification provides knowledge on species evenness in those habitats, communities and diets or on the level of individual or species specialization in networks, all of which is very useful in ecological studies. Research on pollination and knowledge of the quantities of pollen transported by pollinators allow for the estimation of plant-pollinator interaction strength and hence it gives a more realistic representations of networks than those made possible using traditional approaches such as observing visits to plants by pollinators 9,13. Metabarcoding has been used in pollen studies to identify pollen in honey 14-16 , insect loads 6-8,17 , insect nests 18 , airborne samples 19 , and to quantify pollen abundance across various sample types. Several studies found significant positive relationships between pollen abundance (estimated using light microscopy) or pollen DNA quantities, and the abundance or the frequencies of high-throughput sequencing reads in experimental samples 10,16,17,20,21 , airborne samples 22,23 , insect pollen loads 21,24-27 or in brood cells of solitary bees 28. Conversely, other studies found low or no significant pollen-sequence abundance relationships when using ITS2 markers applied to pollen provision in...

show abstract

Section: Efficiency Of Microscopy Vs Flow Cytometry In Counting Pollementioning

confidence: 84%

Section: Methodsmentioning

confidence: 99%

Experimental quantification of pollen with DNA metabarcoding using ITS1 and trnL

Baksay

Pornon

Burrus

et al. 2020

Sci Rep

View full text Add to dashboard Cite

show abstract

“…The nuclear ribosomal DNA including internal transcribed spacer (ITS) and the chloroplast intergenic spacer between psaA and ycf3 (PY-IGS) were chosen for phylogenetic reconstruction on the basis of previous studies demonstrating the utility of these markers for resolution at both the genus and species levels within the eudicots and Nepenthaceae (Downie et al 1996;Sang et al 1997;Shi et al 2001;Meimberg 2002;Tan et al 2002;Tate et al 2003;Alejandro et al 2008;Miranda et al 2010). A previous study attempted to use ITS in Droseraceae but had unsatisfactory results (Miranda et al 2010). Total genomic DNA was extracted from leaf base (Aldrovanda and Dionaea), leaf lamina (Ancistrocladus, Dioncophyllum, Drosera, and Drosophyllum), and the lamina-like region of the leaf base (Nepenthes and Triphyophyllum) by means of a cetyltrimethyl ammonium bromide (Doyle and Doyle 1987) or modified sodium dodecyl sulfate and sodium chloride protocol (Edwards et al 1991).…”

Section: Molecular Marker Samplingmentioning

confidence: 99%

A Sticky Situation: Assessing Adaptations for Plant Carnivory in the Caryophyllales by Means of Stochastic Character Mapping

Renner

Specht

2011

International Journal of Plant Sciences

View full text Add to dashboard Cite

JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms of scholarship. For more information about JSTOR, please contact support@jstor.org.The University of Chicago Press is collaborating with JSTOR to digitize, preserve and extend access to International Journal of Plant Sciences.Phylogenetic relationships among carnivorous plants of the angiosperm order Caryophyllales have been explored, although a robust phylogeny encompassing all carnivorous genera is absent. We sample nuclear ribosomal spacer (internal transcribed spacer) and chloroplast intergenic spacer (PY-IGS), along with previously sequenced DNA from members of the noncore Caryophyllales, for use in Bayesian statistics and maximum likelihood-based searches of phylogeny. Taxonomic relationships across genera are refined, and three strongly supported clades are identified: monophyletic Droseraceae, Nepenthaceae, and a third clade containing Ancistrocladaceae, Dioncophyllaceae, and Drosophyllaceae. In combination with phylogenetic reconstruction, stochastic character mapping is used to assess evolutionary changes in the morphology of glands that are found on the lamina and involved in the digestion of prey. The presence of sessile glands is identified as the likely ancestral character state, and stalked and pitted glands are suggested to have been acquired independently by ingroup and outgroup taxa. Additionally, in some genera we found a lack of association between gland vasculature and plant carnivory, demonstrating that the internal architecture of glands is not indicative of whether the plant is a functional carnivore. Finally, we discuss how adaptive changes resulting in the evolution of the carnivorous gland may have occurred either by emargination of the leaf blade or homologous transformation of pinnae.

show abstract

“…For amplifying the ITS region from older herbarium specimens, internal primers were used to amplify ITS in two overlapping fragments: ITS1: ITS7A and ITS2B (CTCGATGGAACACGGGATTCTGC, based on Kim & Jansen, 1994); ITS2: ITS3 (GCATCGATGAAGAACGCAGC, Kim & Jansen, 1994) and ITS4 (White & al., 1990). Bovine serum albumin (BSA) was used as an adjuvant at a concentration of 1% to avoid mis-amplification from fungal contamination in the ITS reaction of sample K26 (De Miranda & al., 2010). Without the addition of BSA, amplification resulted in a smeared product.…”

Section: ■ Materials and Methodsmentioning

confidence: 99%

Widespread morphological parallelism in Korthalsella (Santalaceae, tribe Visceae): A molecular phylogenetic perspective

Sultan

Robertson

Callmander

et al. 2019

TAXON

View full text Add to dashboard Cite

Korthalsella (Santalaceae, tribe Visceae) mistletoes are hemiparasitic plants that are widespread on islands and continental regions around the Indian and Pacific Oceans. In this study, we add key taxa to a previously generated dataset to produce a more inclusive phylogenetic analysis of the genus. The resulting nuclear ITS and plastid trnL‐F phylogenies reveal that the historical sectional classifications based on morphology are not supported. Instead, it appears that widespread morphological parallelism has occurred throughout Korthalsella. Geographical distribution seems to be a better indicator of phylogenetic relatedness as species found in the same geographic region, island or island group generally are more closely related to one another than species sharing similar morphological characters in other areas. We find greater support for recognition of species as local endemics rather than wide‐ranging taxa. Given these results, taxonomic changes that recognise previously described taxa are proposed, but other changes will require further study of broadly distributed taxa.

show abstract

Plant or fungal sequences? An alternative optimized PCR protocol to avoid ITS (nrDNA) misamplification

Abstract: The nuclear ribosomal DNA internal transcribed spacers (ITS1 and ITS2)

Cited by 13 publications

References 34 publications

Experimental quantification of pollen with DNA metabarcoding using ITS1 and trnL

Experimental quantification of pollen with DNA metabarcoding using ITS1 and trnL

A Sticky Situation: Assessing Adaptations for Plant Carnivory in the Caryophyllales by Means of Stochastic Character Mapping

Widespread morphological parallelism in Korthalsella (Santalaceae, tribe Visceae): A molecular phylogenetic perspective

Contact Info

Product

Resources

About