Exploitation of mitochondrial nad6 as a complementary marker for studying population variability in Lepidoptera

Abstract

The applicability of mitochondrial nad6 sequences to studies of DNA and population variability in Lepidoptera was tested in four species of economically important moths and one of wild butterflies. The genetic information so obtained was compared to that of cox1 sequences for two species of Lepidoptera. nad6 primers appropriately amplified all the tested DNA targets, the generated data proving to be as informative and suitable in recovering population structures as that of cox1. The proposal is that, to obtain more robust results, this mitochondrial region can be complementarily used with other molecular sequences in studies of low level phylogeny and population genetics in Lepidoptera.

Genetic variability and demographic history ofHeliothis virescens(Lepidoptera: Noctuidae) populations from Brazil inferred by mtDNA sequences

“…The analyzed cox1, cox2 and nad6 fragments were of 1486 bp, 682 bp and 501 bp, respectively (GenBank accession numbers: cox1 JN798937–JN799050, cox2 JN799051–JN799151 and nad6 JN109017–JN109038 (Silva-Brandão et al ., in press) and JN799152–JN799250). The mean genetic distance (uncorrected p -distance, Nei & Kumar (2000)) among cox1 haplotypes was 0.001 (0–0.003), 0 (0–0.004) for cox2 , and 0.001 (0–0.006) for nad6 (table 2).…”

A new Hermeuptychia (Lepidoptera, Nymphalidae, Satyrinae) is sympatric and synchronic with H. sosybius in southeast US coastal plains, while another new Hermeuptychia species – not hermes – inhabits south Texas and northeast Mexico

“…Data for specimens are in Table 1 . Specimens 4–11 were not examined and their identification follows that of the authors who performed sequencing studies and analyses ( Peña et al 2010 , Silva-Brandão et al 2011 , Seraphim et al 2014 ). Percent difference and the number of different nucleotides are shown below and above the diagonal in the matrix, respectively, and the length of each sequence segment (bp) used in the analysis is on the diagonal.…”

Using population genetic methods to identify the origin of an invasive population and to diagnose cryptic subspecies ofTelchin licus(Lepidoptera: Castniidae)

“…1480 bp) and the subunit 6 of the nicotinamide adenine dinucleotide dehydrogenase ( nad6, ca . 500 bp) were amplified using the follow primers combinations: LCO (5′ GGTCAACAAATCATAAAGATATTGG) + HCO (5′ TAAACTTCAGGGTGACCAAAAAATCA) (Folmer et al ., 1994) and Jerry (5′ CAACATTTATTTTGATTTTTTGG 3′) + PatII (5′ TCCATTACATATAATCTGCCATATTAG 3′) (Caterino et al ., 2001) for cox1 , and tPro-J10090 (5′ ATCWATAATCTCCAAAATTAT 3′) + ND6-N10624 (5′ GGNCCATAAAAAATATTWGT 3′) (Silva-Brandão et al ., 2011) for nad6 . Reactions were done in a 25 μl final volume using 1 μl of total DNA, 2.0 mM of MgCl 2 , 40 μM of dNTPs, 0.2 μM of each primer, 1 U of GoTaq DNA Polymerase (Promega, Madison, WI, USA), and 10% of 10 × Taq buffer.…”

“…The PCR program to amplify cox1 included an initial denaturation step at 95 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 45–47 °C for 30 s, and polymerization at 72 °C for 1.5 min, followed by an extension step at 72 °C for 10 min (Silva-Brandão et al ., 2005). The amplification protocol for nad6 was as follows: an initial denaturation step at 94 °C for 5 min, 35 cycles of denaturation at 94 °C for 45 s, annealing at 45 °C for 45 s, and elongation at 60 °C for 1.5 min, followed by an extension step at 60 °C for 5 min (Silva-Brandão et al ., 2011). Amplicons were purified of primers and deoxynucleotides with ExoSAP-IT (GE Healthcare, Bucks, UK), and then sequenced by ABI Prism BigDye Kit protocol.…”