Differential expression of metallothionein type-2 homologues in leaves and roots of Black pepper (Piper nigrum L)

Abstract

Black pepper (Piper nigrum L.), member of the family Piperaceae is indigenous to India and is one of the most widely used spices in the world. In this paper we report the results of our attempts to identify a set of genes differentially expressed in the leaves of Piper nigrum, which could facilitate targeted engineering of this valuable crop. A PCR-based Suppression Subtractive Hybridization (SSH) technique was used to generate a leaf-specific subtracted cDNA library of Piper nigrum. A tester population of leaf cDNA was subtracted with a root derived driver cDNA. The efficiency of subtraction was confirmed by PCR analysis using the housekeeping gene actin. On sequence analysis, almost 30% of the clones showed homology to metallothionein type-2 gene. The predominance of metallothionein transcripts in the leaf was further confirmed using Real-Time PCR analyses and Northern blot. The possible role of metallothionein type-2 homologues in the leaf is discussed along with the feasibility of using SSH technique for identification of more number of tissue-specific genes from Piper nigrum. Piper nigrum (Black pepper), the most acclaimed member of the family Piperaceae is a perennial climbing vine grown for its berries, which are highly priced as spice and medicine all over the world. India, especially the Southern states, accounts for a major portion of black pepper production. Recently, a very efficient micropropagation strategy through somatic embryogenesis was reported from seeds of Piper nigrum (Nair and Gupta, 2006), which could enable genetic manipulation of this crop for specific agronomic traits including abiotic and biotic stress tolerance. Often, improvement of transgenic traits in plants is achieved by using specific promoters to accomplish high tissue-specific protein production in transgenic plants. In Piper nigrum, promoters with leaf and root targeted expression would ensure that the gene product will not be present in the edible portions. Moreover, native promoters are known to mimic the expression of endogenous genes more effectively and do not appear to be greatly affected by gene silencing (Song et al., 2000). Having a resource of candidate genes and promoters would enable effective development of more acceptable transgenic varieties. Previously, our group has used SSH technique, which is a modified PCR based cDNA subtraction, to successfully generate a defense gene enriched subtracted cDNA library in the resistant wild pepper (Piper colubrinum Link) (Dicto and Manjula, 2005). In the present study, Suppression Subtractive Hybridization strategy was used to identify a set of genes preferentially expressed in the leaf tissue of Piper nigrum and we report here the results of the forward subtraction using leaf as the tester and root as the driver population.Fresh vine cuttings of Piper nigrum var Panniyur-I were procured from the Kerala Agricultural University, Vellayani, Trivandrum, Kerala, India and transferred to pots containing soil and sand mixture in 3:1 proportion. They were maintained in th...

Identification of sequences expressed during compatible black pepper—Fusarium solani f. sp. piperis interaction

“…piperis infection by SSH in order to improve our understanding about this plant-pathogen interaction, since this crop production is largely affected by root rot disease in the Amazon region. Our subtraction process was validated by PCR amplification of constitutively expressed actin gene that was drastically reduced in subtracted sample appearing first at 33 cycles, as reported by others (Alex et al 2008;Fan et al 2010).…”

“…RNA from non-inoculated plants at 3 and 7 dpi. The subtraction process was validated by PCR analysis using specific primers for the P. nigrum housekeeping actin gene, as described by Alex et al (2008). The actin primers used were Act-F: 5 0 acatccgctggaaggtgc3 0 and Act-R: 5 0 tctgtatggtaacattgtgctc3 0 .…”