Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

Abstract

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S-ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E 9 , B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E 9 , B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.

Evaluation of Metarhizium anisopliae var. anisopliae (Deuteromycotina: Hyphomycete) Isolates and their Effects on Subterranean Termite Coptotermes curvignathus (Isoptera: Rhinotermitidae)

“…DNA was extracted from the mycelia powder using GF-1 Vivantis Bacterial DNA Extraction Kit (Vivantis) according to the manufacturer's protocol with slight modification for the isolation of total DNA. PCR amplification of fungal DNA was performed using specific primer sets ITSMET (5'TCTGAATTTTTTATAAGTAT-3') and ITS4 (5'TCCGTAGGTGAACCTGCGG-3') to generate a PCR product of 440 bp [17] . The reaction mixture in 50 µL contained 10X Buffer A, 2 nM dNTP mix, 50 mM MgCl 2 (Vivantis), 2U Taq DNA polymerase (Fermentas), 0.25 µL of each primer.…”

Species confirmation of fungal isolates by molecular analysis

“…Different molecular techniques were used for various applications and on different fungi [7][8][9][10], including identifi cation using RAPD [11][12][13]. Since its development, the RAPD protocol has acquired a diversity of uses, such as: the establishment of the genetic R. Thakur 1 ( ) · S. S. Sandhu similarity degree between individuals within a population [14], the construction of genetic maps as well as the localization of economically interesting genes [15], the production of a genomic fi ngerprint [16], the evaluation of recombination processes [17] and for the study of genetic diversity along with the identifi cation of species and isolates including entomopathogenic fungi [18,19].…”

Distribution, occurrence and natural invertebrate hosts of indigenous entomopathogenic fungi of Central India

“…Additional research is needed to clarify phylogenetic relationships among all the species of indigenous entomopathogenic fungi collected during these surveys. Morphological characters are limited in their ability to predict the species therefore; PCR-based molecular analysis [33,34] will be valuable in future population studies, which will further help in developing a long-term management and conservation program required to protect these species. The selection of fungal entomopathogens for further development as commercial mycoinsecticide is possibly the most critical step in this process.…”