Expression and purification of the immunogenically active fragment B of the Park Williams 8 Corynebacterium diphtheriae strain toxin

Abstract

The construction of a hexahistidine-tagged version of the B fragment of diphtheria toxin (DTB) represents an important step in the study of the biological properties of DTB because it will permit the production of pure recombinant DTB (rDTB) in less time and with higher yields than currently available. In the present study, the genomic DNA of the Corynebacterium diphtheriae Park Williams 8 (PW8) vaccine strain was used as a template for PCR amplification of the dtb gene. After amplification, the dtb gene was cloned and expressed in competent Escherichia coli M15™ cells using the expression vector pQE-30™. The lysate obtained from transformed E. coli cells containing the rDTB PW8 was clarified by centrifugation and purified by affinity chromatography. The homogeneity of the purified rDTB PW8 was confirmed by immunoblotting using mouse polyclonal anti-diphtheria toxoid antibodies and the immune response induced in animals with rDTB PW8 was evaluated by ELISA and dermonecrotic neutralization assays. The main result of the present study was an alternative and accessible method for the expression and purification of immunogenically reactive rDTB PW8 using commercially available systems. Data also provided preliminary evidence that rabbits immunized with rDTB PW8 are able to mount a neutralizing response against the challenge with toxigenic C. diphtheriae.

Plasmid instability when the <i>hsp</i>60 gene promoter is used to express the protective non-toxic fragment B of the diphtheria toxin in recombinant BCG

“…The DNA fragment corresponding to the dtb PW8 gene was amplified from the C. diphtheriae genomic DNA by Polymerase Chain Reaction (PCR) using primers dtb F (5'CGTCTAGAAGGTAGCTCATTGTC3') and dtb R (5'GCTCTAGACCCCACTACCTTTC3') designed from the sequence encoding the diphtheria toxin, GenBank accession code K01722 [16]. The PCR reaction was performed in the Gene Amp PCR System 2400 thermo cycler (Perkin Elmer) with 30 cycles of 5 minutes denaturation at 94˚C, 1.5 minutes annealing at 55˚C and 2 minutes extension at 50˚C.…”

“…Recombinant BCG clones were selected after 14 -21 days of incubation at 37˚C on Middlebrook 7H10 agar plates containing kanamycin, expanded in Middlebrook 7H9 broth with kanamycin at 37˚C and 2.0 mL aliquots of each culture were harvested at mid-log growth phase, lysed and subjected to 12% SDS-PAGE. After separation in the SDS gel, proteins were electrotransferred to nitrocellulose membranes (Bio-Rad, Hercules, California) and subjected to immunoblotting analyses to detect the expression of the DTB protein using mice anti-toxoid polyclonal antibodies (1:5000 dilution), according to standard procedures described in our previews studies [16]. Recombinant BCG clones were also analyzed with regards to plasmid integrity to confirm the presence of the dtb PW8 gene by restriction analyses with XbaI of plasmids recovered from rBCG expressing dtb PW8 , or not [20].…”

Desenvolvimento da metodologia para realizar a qualificação de performance do biorreator utilizado para produção de toxina diftérica.

“…A toxina diftérica é um tipo de proteína tóxica que contem dois fragmentos, denominados A e B. O fragmento B se liga aos receptores da superfície das células dos hospedeiros (NASCIMENTO et al, 2010).…”

“…A expressão do fragmento B recombinante da toxina diftérica em outros organismos procariotos, além de C. diphtheriae, é uma alternativa necessária para o entendimento do papel da toxina diftérica no desenvolvimento e severidade dos processos infecciosos toxêmicos (NASCIMENTO et al, 2010).…”

“…O peso molecular da molécula da toxina diftérica é de aproximadamente 58 kDa (PAPPENHEIMER, 1984). O fragmento A tem peso molecular de 21 kDa, é estável e não-coagulável pelo calor.…”