Prokaryotic expression of a novel mouse pro-apoptosis protein PNAS-4 and application of its polyclonal antibodies

Abstract

Mouse PNAS-4 (mPNAS-4) has 96% identity with human PNAS-4 (hPNAS-4) in primary sequence and has been reported to be involved in the apoptotic response to DNA damage. However, there have been no studies reported of the biological functions of mPNAS-4. In studies conducted by our group (unpublished data), it was interesting to note that overexpression of mPNAS-4 promoted apoptotic death in Lewis lung carcinoma cells (LL2) and colon carcinoma cells (CT26) of mice both in vitro and in vivo. In our studies, mPNAS-4 was cloned into the pGEX-6P-1 vector with GST tag at N-terminal in Escherichia coli strain BL21(DE3). The soluble and insoluble expression of recombinant protein mPNAS-4 (rmPNAS-4) was temperature-dependent. The majority of rmPNAS-4 was insoluble at 37°C, while it was almost exclusively expressed in soluble form at 20°C. The soluble rmPNAS-4 was purified by one-step affinity purification, using a glutathione Sepharose 4B column. The rmPNAS-4 protein was further identified by electrospray ionization-mass spectrometry analysis. The search parameters of the parent and fragment mass error tolerance were set at 0.1 and 0.05 kDa, respectively, and the sequence coverage of search result was 28%. The purified rmPNAS-4 was further used as immunogen to raise polyclonal antibodies in New Zealand white rabbit, which were suitable to detect both the recombinant and the endogenous mPNAS-4 in mouse brain tissue and LL2 cells after immunoblotting and/or immunostaining. The purified rmPNAS-4 and our prepared anti-mPNAS-4 polyclonal antibodies may provide useful tools for future biological function studies for mPNAS.

Improved therapeutic efficacy against murine carcinoma by combining honokiol with gene therapy of PNAS‐4, a novel pro‐apoptotic gene

“…In addition, we found that overexpression of PNAS-4 efficiently inhibited growth of LL2 cells, human ovarian cancer SKOV3 cells, and lung adenocarcinoma A549 cells through induction of apoptosis. (29)(30)(31) More recently, we have confirmed that PNAS-4 enhances the sensitivity of lung cancer to gemcitabine. (32) Similarly, we decided to investigate whether PNAS-4 could also potentiate the antineoplastic effects of honokiol.…”

“…In addition, we found that overexpression of PNAS‐4 efficiently inhibited growth of LL2 cells, human ovarian cancer SKOV3 cells, and lung adenocarcinoma A549 cells through induction of apoptosis. ( 29–31 )…”

“…One part of the harvested cells was used to isolate RNA and then subjected to RT‐PCR for amplification of the coding region of mPNAS‐4, and the rest was used for the detection of protein expression by western blot analysis according to the method described previously, ( 37 ) using the anti‐mPNAS‐4 polyclonal antibodies produced by us. ( 29 ) For detection of mPNAS‐4 expression in vivo , when mice were killed at the end of the experiment, the tumor tissues were collected for detecting mPNAS‐4 expression by RT‐PCR. The primers used for amplification of mPNAS‐4 (608 bp) were as follows: 5′‐GCGGATCCGCCACC ATGGCCAACCAGCCC ATCATC‐3′ and 5′‐CCGCTCGAGCTATAGTTTTGTGTGGCGC CCAGG‐3′, whereas the primers used for amplification of GAPDH (187 bp) were designed as reported previously.…”

Prokaryotic expression, purification and characterization of a novel pro‐apoptosis protein hPNAS‐4

“…Based on our previous work on PNAS‐4 [4,5,8,9], in the present study we mainly describe the purification, characterization, polyclonal antibody production and subcellular localization of hPNAS‐4 protein. This purified hPNAS‐4 protein and the prepared polyclonal antibodies may provide a powerful tool for the study of the apoptotic mechanisms of hPNAS‐4.…”

“…Recently, the homologous genes of hPNAS‐4 from zebrafish [3], Xenopus laevis [4], mouse [5] and pig [6] respectively have been cloned and primarily investigated. The zPNAS‐4 (zebrafish PNAS‐4) is a key regulator of cell movement during gastrulation, because knocking down zPNAS‐4 causes gastrulation defects with a shorter and broader axis, as well as a posteriorly mispositioned prechordal plate [3].…”