Rapid detection of bovine coronavirus by a semi-nested RT-PCR

Abstract

RESUMO.-[Detecção rápida do Coronavírus Bovino (BCoV) por meio de uma semi-nested RT-PCR.]O Coronavírus bovino (BCoV) pertence ao grupo 2 do gêne-ro Coronavirus (Nidovirales: Coronaviridae) e é agente causador de enterites tanto em bezerros como em bovinos adultos, bem como de doença respiratória em bezerros. O presente estudo teve por objetivo desenvolver uma seminested RT-PCR para a detecção do BCoV com base em seqüências representativas e recentes do gene do nucleocapsídeo, região conservada do genoma dos coronavírus. Três primers foram desenhados, a primeira amplificação com um fragmento esperado de 463pb e a segunda (semi-nested) com um fragmento esperado de 306pb. A sensibilidade analítica foi determinada pela diluição do BCoV cepa Kakegawa (título HA: 256) na base de 10 em água ultra-pura tratada com DEPC, em soro fetal bovino (SFB) e em uma suspensão fecal negativa para o BCoV, onde foram encontrados resultados positivos até a diluição de 10 -2 , 10 -3 e 10 -7 , respectivamente. Este resultado sugere que a quantidade total de RNA na amostra influencia na precipitação dos pellets pelo método de extração utilizado. Quando se utiliza amostra fecal, a grande quantidade de RNA total funciona como carreadora do RNA do Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10 -2 , 10 -3 and 10 -7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.

Genetic diversity of BCoV in Brazilian cattle herds

“…In order to detect BCoV, a reaction was carried out with semi‐nested RT‐PCR using specific primers for the gene that codes for BCoV N protein, as described by Asano et al . (). The RT‐PCR reaction was carried out by adding 2.5 μ L of RNA to the PCR mix (25 μ L of 2x Reaction Mix (Invitrogen™), 0.2 mmol/L of BCoV1 (5′AGAGCTCAAYCCAAGCAA ACTGY 3′) and BCoV2 (5′AG CAGACCTTCCTGAGCCTTCAAT 3′), 2 μ L of SuperScript III RT Mix ̸Platinum Taq (Invitrogen™) and 16 μ L of DEPC‐treated water to achieve a final volume of 25 μ L, heated to 94°C/4 min followed by 35 cycles of 94°C/1 min, 50.2°C/30 s, 72°C/45 s and 72°C/5 min for the final extension.…”

Reação de hemi-nested RT-PCR dirigida ao gene da hemaglutinina-esterase do Coronavírus Bovino

“…Though the semi-nested protocol has shown a high analytical sensitivity, with a detection limit at 10 -6 dilution of the Kakegawa strain, this sensitivity was lower when compared to those described by Asano et al 20 and Takiuchi et al 21 , who found a detection limit at the 10 -7 dilution of the Kakegawa strain of the same HA titer. Such dissimilarity may be due to the genomic region chosen as the target of the coding region of HE protein, which presents a higher diversity if compared to the coding region of N protein, a highly conserved region 22 , targeted by the authors of the aforementioned studies.…”

Coronavírus bovino: Revisão

“…O BCoV é também autor de infecções respiratórias em bovinos de todas as idades, sendo identificado em amostras de animais convalescentes devido pneumonia, a partir de amostras de fezes, secreções nasais e em pulmões. Sua transmissão assemelha-se com as demais síndromes sendo predominante a forma respiratória (aerossóis) (Asano et al, 2009;Saif, 2010).…”