Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

Abstract

-GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10 -8 , which is 10 5 -fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Comparison of different paternity test panels in sheep

“…Among these techniques, molecular genetics-based paternity tests in particular provide an important contribution to animal husbandry. Nowadays, DNA-based genetic analysis methods are being widely used in paternity testing instead of methods using blood groups, protein and enzyme polymorphisms, and the human leukocyte antigen (HLA), which have low reliability (10,16). In cases where there is doubt, paternity testing may be used as a scientific method to determine the biological father of unknown progeny in livestock and wild populations in order to obtain accurate pedigree information (17).…”