Recognition of the epidemiological significance of Neisseria meningitidis capsular serogroup W135 in the Rio de Janeiro region, Brazil

Barroso, David E.; Rebelo, Maria Cristina

doi:10.1590/s0074-02762007005000104

Cited by 11 publications

(10 citation statements)

References 7 publications

(11 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The amplified product of approximately 1480 bp was sequenced by using the previously described primers 357, 530, 790, 981 in the forward and reverse orientations, as well as primers 8F and 1492R described before. 11 Six additional sequencing primers were also used, primers 1968F (5′GTCGTCAGCTCGTGTCGT GAG3′), 1083F (5′CGTGACATGTTGGGTTAAGTC3′), 1127F (5′ATTAGTTGCCATCATTCAGTT3′), 1333R -(5′CTAGCGATTCC GACTTCATGC3′), 180R (5′TCTCTCAAGACGTATGCGGTA3′), 591R (5′CATCCTGCTTAAGTAACCGTC3′).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Phenotypic and molecular characterization of invasive serogroup W135 Neisseria meningitidis strains from 1990 to 2005 in Brazil

Lemos

Harrison

Lenser

et al. 2010

Journal of Infection

View full text Add to dashboard Cite

Summary Objective Neisseria meningitidis serogroup W135 has been associated with global outbreaks since the 2000 Hajj. Considering that N. meningitidis serogroup W135 is the third most prevalent serogroup isolated in Brazil in the last 10 years, and the possibility that the Hajj-related N. meningitidis serogroup W135 clone has been causing disease in Brazil, the present study characterized invasive N. meningitidis serogroup W135 isolates recovered in Brazil from 1990 to 2005. Methods The isolates were characterized by serotyping, PorA and PorB VR typing, FetA and 16S rRNA typing, multilocus sequence typing (MLST) and pulsed field gel electrophoresis (PFGE). Results Based on MLST, 73% of the isolates were clustered in one major clone of ST-11 complex/ET37 complex. Strains of this clone had the same STs, serotypes and PorA VR types as found in Hajj-related N. meningitidis serogroup W135 clone. One of these strains had the Hajj-2000 outbreak strain genotype, including 16S rRNA gene sequence 31 and 84% relatedness by PFGE. Conclusion Taken together, these data suggest that the Hajj-related N. meningitidis serogroup W135 clone is present in Brazil but has not yet caused a substantial number of infections. Given the emergence of N. meningitidis serogroup W135 globally and the unpredictability of meningococcal disease epidemiology, continued surveillance for this invasive N. meningitidis serogroup W135 clone is needed for control and prevention strategies.

show abstract

Section: Methodsmentioning

confidence: 99%

“…However, since 2000 there has been a significant trend ( p ≤ 0.0001) in the percentage of meningococcal disease caused by serogroup W135 in Brazil (http://www.saude.cve.sp.gov.br). 11,12 N. meningitidis serogroup W135 disease has also recently increased in Argentina, accounting for 28% of cases during the first 5 months of 2008. 13 …”

Section: Introductionmentioning

confidence: 99%

Phenotypic and molecular characterization of invasive serogroup W135 Neisseria meningitidis strains from 1990 to 2005 in Brazil

Lemos

Harrison

Lenser

et al. 2010

Journal of Infection

View full text Add to dashboard Cite

show abstract

“…Brazil reported also an increase on the number of cases of W135 disease in two states: Rio de Janeiro and Rio Grande do Sul. In both cases, the causing strain was found to be that linked to the 2000 Hajj global outbreak [53], [54]. Data presented in this article appear to indicate that serogroup W135 is more often seen among isolates obtained from older patients.…”

Section: Discussionmentioning

confidence: 67%

Laboratory-Based Surveillance of Neisseria meningitidis Isolates from Disease Cases in Latin American and Caribbean Countries, SIREVA II 2006–2010

et al. 2012

View full text Add to dashboard Cite

BackgroundPublished data on the epidemiology of meningococcal disease in Latin America and the Caribbean region is scarce and, when available, it is often published in Spanish and/or in non-peer-reviewed journals, making it difficult for the international scientific community to have access.MethodsLaboratory data on 4,735 Neisseria meningitidis strains was collected and reported by the National Reference Laboratories in 19 Latin American countries and the Caribbean Epidemiology Centre (CAREC) between 2006 and 2010 as part of the work carried out by the SIREVA II network. Serogroup and MIC to penicillin, rifampin and chloramphenicol were determined.ResultsIsolates were mainly obtained from patients <5 years, but each year around 25% of isolates came from adult patients. Serogroup distribution was highly variable among countries. Serogroup C was the main cause of disease in Brazil; the majority of disease seen in the Southern cone was caused by serogroup B, but serogroup W135 strains have increased in recent years. In the Andean and Mexico, Central America and Caribbean regions, serogroups B and C were equally present, and serogroup Y was frequently isolated. Isolates were generally susceptible to chloramphenicol, penicillin and rifampin, but almost 60% of isolates characterized in Southern cone countries presented intermediate resistance to penicillin. Five rifampin-resistant isolates have been isolated in Uruguay and Brazil.ConclusionsSerogroup distribution is highly variable among countries, but some geographic structuring can be inferred from these data. Epidemiological and laboratory data are scarce among Andean and Mexico, Central America and Caribbean countries. Evaluation and implementation of corrective measures on disease surveillance and reporting systems and the implementation of molecular diagnostic techniques and molecular characterization on meningococcal isolates are advised.

show abstract

“…Rio de Janeiro and Argentina are also seeing similar increases in serogroup W135 MD. 40,41 In addition to outbreaks and epidemics, the Hajj clone is associated with high CFR rates, 42 therefore, molecular characterization of meningococcal invasive strains as well as careful analysis of epidemiological data, not only in RS, but in the entire country, are essential to detect and prevent the spread of this strain by appropriate available vaccines. 43 Serogroup C was identified in 9 (12%) cases in this study, from which 6 (67%) have the genotype C:P1.22,14-6:ST-103 complex.…”

Section: Discussionmentioning

confidence: 99%

High prevalence of Neisseria meningitidis hypervirulent lineages and emergence of W135:P1.5,2:ST-11 clone in Southern Brazil

Weidlich

Baethgen

Mayer

et al. 2008

Journal of Infection

View full text Add to dashboard Cite

Recognition of the epidemiological significance of Neisseria meningitidis capsular serogroup W135 in the Rio de Janeiro region, Brazil

Cited by 11 publications

References 7 publications

Phenotypic and molecular characterization of invasive serogroup W135 Neisseria meningitidis strains from 1990 to 2005 in Brazil

Phenotypic and molecular characterization of invasive serogroup W135 Neisseria meningitidis strains from 1990 to 2005 in Brazil

Laboratory-Based Surveillance of Neisseria meningitidis Isolates from Disease Cases in Latin American and Caribbean Countries, SIREVA II 2006–2010

High prevalence of Neisseria meningitidis hypervirulent lineages and emergence of W135:P1.5,2:ST-11 clone in Southern Brazil

Contact Info

Product

Resources

About