Analysis of the first and second internal transcribed spacer sequences of the ribosomal DNA in Biomphalaria tenagophila complex (Mollusca: Planorbidae)

Abstract

The first and second internal transcribed spacer regions (ITS1 and ITS2)

ITS2 variability of Biomphalaria (Mollusca, Planorbidae) species from the Paranapanema Valley (São Paulo State, Brazil): diversity patterns, population structure, and phylogenetic relationships

“…These studies have largely supported the pivotal body of work on the taxonomy of Neotropical Biomphalaria carried out by malacologist Lobato Paraense (Paraense, 2001) and, additionally, uncovered interesting patterns of intraspecific variability (Mavárez et al, 2002;Vidigal et al, 2004).…”

“…In contrast to B. glabrata, the clade containing B. tenagophila, B. t. guaibensis, and B. occidentalis sequences displayed a polyphyletic pattern (the B. tenagophila complex, Spatz et al, 1999;Vidigal et al, 2004). The B. tenagophila sequences were observed in two different branches (T1 and T2).…”

“…Species of planorbid snails belonging to the genus Biomphalaria, which includes the vectors of the blood fluke Schistosoma mansoni, have recently received increasingly attention in molecular systematic and phylogeography studies (Campbell et al, 2000;Vidigal et al, 2000Vidigal et al, , 2004DeJong et al, 2001;Mavárez et al, 2002;Pointier et al, 2005). These studies have largely supported the pivotal body of work on the taxonomy of Neotropical Biomphalaria carried out by malacologist Lobato Paraense (Paraense, 2001) and, additionally, uncovered interesting patterns of intraspecific variability (Mavárez et al, 2002;Vidigal et al, 2004).…”

“…Furthermore, ITS sequence studies have revealed and/or confirmed sub-structuring within widely distributed species such as B. glabrata and B. tenagophila (Mavárez et al, 2002;Vidigal et al, 2004), adding to the body of evidence indicating that these nominal taxa may constitute complexes of cryptic species (Woodruff and Mulvey, 1997;Spatz et al, 1999). In these circumstances, the investigation of genetic variability patterns across the range of distribution of these species takes a prominent role in helping to elucidate how many independently evolving entities there are and which geographical areas they occupy.…”

The use of the polymerase chain reaction and restriction fragment length polymorphism technique associated with the classical morphology for characterization of Lymnaea columella, L. viatrix, and L. diaphana (Mollusca: Lymnaeidae)

“…rDNA-ITS1 amplification -The ITS1 region was amplified using the primers ETTS2 (5'-TAACAAGG TTTCCGTAGGTGAA-3') (Kane & Rollinson 1994) and ITS1r (5' ACGAGCGAGTGATCCACCGC 3') (Vidigal et al 2004), anchored, respectively, in the conserved ends of 18S and 5.8S ribosomal genes. PCR amplification was undertaken in a final volume of 10 µl consisting of: 1-10 ng of DNA, buffer (1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl, pH 8.5), 200 µM each dNTP, 0.5 U of Taq DNA polymerase, 5.0 pmol of each primer.…”