A Heminested Polymerase Chain Reaction for the Detection of Brazilian Rabies Isolates from Vampire Bats and Herbivores

Abstract

A heminested-PCR (hn-PCR) using primers to the nucleoprotein-coding gene in a nested set was evaluated in the detection of Brazilian strains of rabies virus (RV).Rabies is a widespread zoonosis, which has been of great concern due to its ability to determine a fatal acute encephalomyelitis when the host is bitten by an ill animal (Wilkinson 1988). The causing agent is a virus that belongs to the Lyssavirus genus in the Rhabdoviridae family. Based on phylogenetic analyses of the nucleoproteincoding gene (N gene), the Lyssavirus genus has been divided into seven genotypes. Genotype 1 includes rabies virus (RV) strains (Bourhy et al. 1993). RV genome is composed of a single-stranded, negative-sense, non-segmented RNA that codes for five separate proteins: nucleoprotein, glycoprotein, phosphoprotein, membrane protein and polymerase (Tordo 1991).The World Health Organization (WHO) recommends that the fluorescent-antibody test (FAT) and mouse inoculation test (MIT) carried out simultaneously should be used for the detection of RV (Meslin et al. 1996). FAT is a rapid and low cost technique, which may show positive results, as it is able to detect viral antigens whether they are viable or not (Meslin et al. 1996). However, FAT's efficacy may be jeopardized when decomposed tissue is used. In such cases, PCR may be used as a surrogate due to its more appropriate performance (Sacramento et al. 1991, Kalmovarin et al. 1993.PCR based on N gene has been widely used for diagnostic purposes since it is one of the most conserved fractions in RV (Smith et al.1992, Kalmovarin et al. 1993, Heaton et al. 1997, Crepin et al. 1998, Heaton et al. 1999, Black et al. 2000.The aim of this study was to design primers based on RV genotype 1 N gene and to evaluate the performance of a hn-PCR for direct RV detection in clinical samples. Primers were based on the sequences of genotype 1 strains, including one Brazilian isolate (Kissi et al. 1995). Virus sequences were aligned by using the Clustal X computer program (Thompson et al. 1997) and the oligonucleotides were designed to recognize regions with high degree of similarity within the N genes. The segments that were selected for primer design are located in the middle of the N gene. Kissi et al. (1995) have demonstrated that such gene fraction shows a striking level of similarity among RV isolates. The physical and chemical properties of the primer were predicted by using the Oligo 4.0 computer program (Rychlik & Rhoads 1989).Primers with a maximum of three mismatches with any aforementioned sequence and no mismatch in the 3' terminal nucleotide were chosen. As the efficiency of PCR is inversely related to the length of the sequence, primers were chosen based on the shortest flanking distance. Primer

Profile of Cytokines and Chemokines Triggered by Wild-Type Strains of Rabies Virus in Mice

“…Primers for the 18S murine genes were supplied by IDT ® and used as housekeeping genes; primers for the RABV N protein gene were manufactured as described previously. 43 Mouse QuantiTect ® Primer Assays from Qiagen ® (Hilden, Germany) were used to evaluate the expression levels of CCL2, OAS1, IL-2, IL-6, IL-12, TNF-α, IFN-γ, IFN-β, CXCL10, CD200R, and IGF-1 genes.…”

Diagnosis and molecular typing of rabies virus in samples stored in inadequate conditions

“…Molecular biology techniques such as reverse transcriptase polymerase chain reaction (RT-PCR) are important diagnostic tools for the rabies virus [9][10][11][12][13]. They have also been used in several retrospective studies using samples stored under inadequate refrigeration for long periods of time [14].…”

Fluorescent antibody test, quantitative polymerase chain reaction pattern and clinical aspects of rabies virus strains isolated from main reservoirs in Brazil

“…Twelve microliters of a mixture containing 4 L RT-Buffer 5×, 2 L DTT (0.1 mM), 4 L de MgCl 2 (50 mM), 1 L RNAse Out (Invitrogen ® ) and 1 L SuperScript II (200 U/L) were added to each sample with final volume of 20 L. The samples were incubated in a conventional PCR thermocycler following the cycle of 25 • C/10 min, 42 • C/1 h and 35 min, 70 • C/15 min.The qRT-PCR was then performed using 2 L of complementary DNA, 1 L of each primer (0.2 g) and 21 L of Sybr Green (Promega ® ), totaling a final volume of 25 L in plates with 96 wells (Applied Biosystems ® ). Primer P510 [sense (ATA-GAGCAGATTTTCGAGACAGC)] and primer P784 [anti-sense (CCTCAAAGTTCTTGTGGAAGA)] targeting the N gene were previously described 22. All samples were processed twice in order to ensure reliability of results.…”