A simple PCR-based procedure for plaque diagnosis

Leal, Nilma Cintra; Abath, Frederico G. C.; Alves, Luiz Cláudio Pinto de Sá; Almeida, Alzira Maria Paiva de

doi:10.1590/s0036-46651996000500009

Cited by 16 publications

(18 citation statements)

References 6 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…2 Several polymerase chain reaction (PCR) assays have been developed recently to identify Y. pestis in different materials, including fleas, by targeting various chromosomal and extrachromosomal genes for amplification. [3][4][5][6][7][8][9] The use of the PCR assay for this purpose has been shown to be more rapid and sensitive than mouse inoculation, 9 which was the previous gold standard for identifying Y. pestis in fleas.…”

Section: Introductionmentioning

confidence: 99%

Quantitative competitive PCR as a technique for exploring flea-Yersina pestis dynamics.

Engelthaler

Hinnebusch²,

Rittner³

et al. 2000

The American Journal of Tropical Medicine and Hygiene

View full text Add to dashboard Cite

Abstract. We used a quantitative competitive polymerase chain reaction assay to quantify Yersinia pestis loads in fleas and bacteremia levels in mice that were used as sources of infectious blood meals for feeding the fleas. Xenopsylla cheopis, the Oriental rat flea, achieved higher infection rates, developed greater bacterial loads, and became infectious more rapidly than Oropsylla montana, a ground squirrel flea. Both flea species required about 10 6 Y. pestis cells per flea to be able to transmit to mice. Most fleas that achieved these levels, however, were incapable of transmitting. Our results suggest that at the time of flea feeding, host blood must contain Ն10 6 bacteria/ml to result in detectable Y. pestis infections in these fleas, and Ն10 7 bacteria/mL to cause infection levels sufficient for both species to eventually become capable of transmitting Y. pestis to uninfected mice. Yersinia pestis colonies primarily developed in the midguts of O. montana, whereas infections in X. cheopis often developed simultaneously in the proventriculus and the midgut. These findings were visually confirmed by infecting fleas with a strain of Y. pestis that had been transformed with the green fluorescent protein gene.

show abstract

Section: Introductionmentioning

confidence: 99%

Quantitative competitive PCR as a technique for exploring flea-Yersina pestis dynamics.

Engelthaler

Hinnebusch²,

Rittner³

et al. 2000

The American Journal of Tropical Medicine and Hygiene

View full text Add to dashboard Cite

show abstract

“…pestis DNA from the strains A1122, P.Exu 369, P.Exu 390 and P.CE 882 was used to amplify a 513 bp (base pair) segment of the caf1 gene [15] by C-PCR using the method outlined by Leal et al [6]. The reactions were made in 25 µL of the reaction mixture composed of 50 mM KCl, 10 mM Tris-HCl, 1.5 mM MgCl 2 , 200 mM dNTP, 20 pmol of each primer (F1F: CAGGGATCCATGAAAAAAATCAGTTC and F1R: GGGCTCGAGTTGGTTAGATACGGTTA), 20 ng DNA, 1 U Taq DNA polymerase.…”

Section: Amplification Of the Caf1 Gene From Y Pestis Strains By Conmentioning

confidence: 99%

The Development of a Loop-Mediated Isothermal Amplification (LAMP) Procedure for Plague Diagnostic

Nunes¹,

Mendes-Marques²,

Almeida³

et al. 2014

AJAC

Self Cite

View full text Add to dashboard Cite

Plague caused by Yersinia pestis is one of the infectious diseases subject to the International Health Regulations (IHR). Permanent monitoring of the focal plague areas is mandatory in order to enable prompt control measures to prevent the spread of the disease. Therefore, the availability of efficient diagnosis tests is of paramount importance. Here, we describe a loop-mediated isothermal amplification (LAMP)-based procedure for rapid Y. pestis detection. We constructed a set of LAMP primers, which were used in assays to establish the reaction conditions that would lead to the quick visualization of the results by evaluating the test tube with the naked eye. The primers were specifically designed to target the caf1 gene located on pFra/Tox (pMT), a prototypical plasmid of Y. pestis. The LAMP procedure was performed at 65˚C for 45 min in a water bath and allowed for the detection of at least 10 pg of bacterial DNA. Due to its simplicity, specificity, sensitivity and rapidity, the LAMP technique is an additional tool that may be implemented in routine plague diagnoses, especially in emergencies.

show abstract

“…The latter allows for retrospective plague case study and localizes bacteria while retaining tissue morphologic features [91]. Several multiplex-PCR, classical, and real-time PCR, targeting specific segments of Y. pestis DNA and associated plasmids, have been developed to detect Y. pestis in patient blood [92], rodent spleen biopsies [93], and in fleas [94,95]. In recent years, the RDT based on F1 antigen detection proved its efficacy and detected 41.6 and 31.0% more positive clinical specimens than did more expensive bacteriological methods and ELISA, respectively [88].…”

Section: Diagnosismentioning

confidence: 99%