Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens

Abstract

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations.

The overview and perspectives of biosensors and Mycobacterium tuberculosis: A systematic review

“…As an ongoing research subject, fluorescent nanomaterials with a minimum of one dimension (≤100 nm) and organic dyes could be used for the better design and fabrication of fluorescent biosensors (Manasreh, 2011). In a research in this regard, Shojaei et al (2014) introduced a nanobiosensor detection method with the advantages of cadmium‐telluride quantum dots (CdTeQDs) and gold nanoparticles onto the platform surface connected with two probes based on the conserved genomic regions of the ESAT‐6 antigen. As is illustrated in Figure 7, QDs and AuNPs were conducted with two sequence‐specific oligonucleotides probes (p1 and p2) to obtain a selective and sensitive sandwich form the FRET‐based biosensor, respectively.…”

“…In a study in this regard, two DNA probes were hybridized with the target on the gold nanoparticle layer, F I G U R E 7 Sandwich-form FRET-based biosensor schematic. In the presence of the target, the AuNPs/P2 moiety optically quenched the QDs/P1 moiety; the presence of the target molecules turned the AuNPs/P2 into fluorescence acceptor close enough to the QDs/P1 resulting in a FRET signal (Shojaei et al, 2014).…”

“…Today, the detection systems based on sensory methods are applied to identify resistance to isoniazid (Ckumdee et al, 2017), rifampin (Miodek et al, 2015;Rachkov et al, 2013;Zribi et al, 2016), pyrazinamide (Rueda et al, 2018), and first-and second-line drugs, including anti-TB antibiotics (e.g., isoniazid, rifampin, ethambutol Genomic DNA of M. tb 20 mer: 5′-CTC GTC CAG CGC CGC TTC GG-3′ (Mohamad et al, 2017) Genomic DNA of M. tb 20 mer: 5′-CTC GTC CAG CGC CGC TTC GG-3′ (Ng et al, 2015) Not mentioned in the reference 20 mer: 5′-CTC GTC CAG CGC CGC TTC GG-3′ (Issa et al, 2010) IS6110 sequence 10 mer: 5′-GGTGAGGTCT-3′ (C. Liu et al, 2014) Not mentioned in the reference 21 mer: 5′-GGTCTTCGTGGCCGGCGTTCA-3′ (Mogha et al, 2018) Not mentioned in the reference 21 mer: 5′-IAC III CAA TCC AII IC-3′ (Nurmalasari et al, 2015) rpoB gene 15 mer: 5′-GATACTTCTATCACC-3′ (Miodek et al, 2015) Not mentioned in the reference 21 mer: 5′-GGT CTT CGT GGC CGG CGT TCA-3′ (Torati et al, 2016) Not mentioned in the reference 15 mer: 5′--GATACTTCTATCACC-3′ (Zribi et al, 2016) MPT64 antigen 77 bp aptamer: 5′-[Btn]GTACAAACGACGGCCAGTCCTTGGGATGATTCAAGCAAAG CCTCACGCCTACGGCTAAGTCATAGCTGTCTCTCCTG-3′ IFN-γ 37 bp aptamer: 5′-GGGGTTGGTTGTGTTGGGTGTTGTGTCCAACCCCCCC-3′ (Y. Liu et al, 2010) Genomic DNA of M. tb 25 mer: 5′-biotin GACCAAATAGGTATCGGCGTGTTCA-3′ (Yesil et al, 2016) Not mentioned in the reference 21 mer: 5′-GGT CTT CGT GGC CGG CGT TCA-3′ (Prabhakar et al, 2010) Genomic DNA of M. tb 24 mer: 5′-CGG TGG CGT GTT CTT TGT GCA ATA-3′ (Hsu et al, 2013) rpoB gene 21 mer: 5′-ACCCACAAGCGCCGACTGTTG-3′ (Rachkov et al, 2013) Genomic DNA of M. tb 22 mer: 5′-CCAACTTTGTTGTCATGCACCC-3′ (Duman & Piskin, 2010) Genomic region of ESAT-6 antigen Probe 1: 5′-NH2 [CH2]6-GTAAGTAAGGGAGGAAC-3′Probe2: 5′-TGCTCCCCT TCGTCAGG-[CH2]6-SH-3′ (Shojaei et al, 2014) IS6110 sequence 15 mer: 5′-ATCCGGCCACAGCCC-3′ (Kaewphinit et al, 2013) IS6110 sequence 5′-SH-[CH2] 6 -TTTTTTGTGGCCATCGTGGAAGCGA-3′ (Kaewphinit et al, 2010) hydrochloride, streptomycin, capreomycin, p-amino salicylic acid, rifabutin, and ethionamide; Ren et al, 2013), in the hopes that these systems continue to improve.…”

“…With the growth of the Mtb cells in the detection media, the NH 3 and CO 2 products were generated, absorbed by the detection compartment, and detected by the ISP system sensitively.F I G U R E 8 Experimental schematic representation LAMP-AuNPs probes based colorimetric assay in this study. The assay consists of visual comparison of test solutions before and after MgSO 4 -induced AuNPs probes aggregation: (a) AuNPs probes alone as blank; (b) AuNPs probes in the presence of a noncomplementary DNA sample as negative; (c) AuNPs probes in the presence of a complementary DNA sample as positive(Shojaei et al, 2014). AuNP, gold nanoparticle; LAMP, loop-mediated isothermal amplification; QD, quantum dot RIZI ET AL.| 17432.12 | Optical biosensorsThis class of biosensors are most commonly applied and use light as a detection source, which could react with target analytes.…”

Evaluation of gamma interferon assay for detection of bovine tuberculosis in inactive foot and mouth disease vaccine administered cattle

“…For this purpose, many diagnostic methods, such as bacterial culture, histopathology, polymerase chain reaction, and ELISA have been developed and widely used to date [4]. The intradermal tuberculin skin test is also used for standard screening for the detection of bovine tuberculosis.…”