‘1-8 interferon inducible gene family’: putative colon carcinoma-associated antigens

Abstract

D bÀ/À xb2 microglobulin (b2m) null mice transgenic for a chimeric HLA-A2.1/D b -b2m single chain (HHD mice) are an effective biological tool to evaluate the antitumour cytotoxic T-lymphocyte response of known major histocompatibility-restricted peptide tumour-associated antigens, and to screen for putative unknown novel peptides. We utilised HHD lymphocytes to identify immunodominant epitopes of colon carcinoma overexpressed genes. We screened with HHD-derived lymphocytes over 500 HLA-A2.1-restricted peptides derived from colon carcinoma overexpressed genes. This procedure culminated in the identification of seven immunogenic peptides, three of these were derived from the 'human 1-8D gene from interferon inducible gene' (1-8D). The 1-8D gene was shown to be overexpressed in fresh tumour samples. The three 1-8D peptides were both antigenic and immunogenic in the HHD mice. The peptides induce cytotoxic T lymphocytes that were able to kill a colon carcinoma cell line HCT/HHD, in vitro and retard its growth in vivo. One of the peptides shared by all the 1-8 gene family primed efficiently normal human cytotoxic T lymphocyte precursors. These results highlight the 1-8D gene and its homologues as putative immunodominant tumour-associated antigens of colon carcinoma.

The human 1‐8D gene (IFITM2) is a novel p53 independent pro‐apoptotic gene

“…Polymerase chain reactions (PCRs) were performed on cDNAs of fresh normal and tumor colon tissues, which were prepared as described earlier 2. Forward primer for human 1‐8D ; 5′CCCAAGCTTGGGGAGGGCTC ACTGAGAACCAT3′.…”

“…Rat embryonic fibroblasts (REFs) were prepared from 2 pregnant Fisher 344 rat‐carrying embryos of 14 days' gestation as described earlier 20. REFs (4 × 10 5 ) were transfected with 3 μg each of c‐Myc , H‐Ras (V12), pcDNA3.1‐ 1 ‐ 8D‐myc (described earlier2), or pcDNA3.1 by a standard Ca 3 (PO 4 ) 2 transfection protocol. Medium was replaced every 3 days and 14 days later foci were scored 21…”

“…Relative expression of 1‐8D gene was detected by performing quantitative real‐time PCR using Platinum SYBR Green (Invitrogen) on an ABI 7000 instrument (Applied Biosystems, Foster City, CA). Primers to specifically amplify 1‐8D gene were described earlier 2. Forward primer for p21 ; 5′ GGCAGACCAGCATGACAGATT3′, reverse primer for p21 ; 5′GCGGATTAGGGCTTCC TCT3′.…”

“…In our previous studies aimed at identifying novel tumor‐associated antigens derived from overexpressed genes in colon carcinoma, we identified 7 immunogenic peptides in HLA‐A2 transgenic mice and in human peripheral blood mononuclear cells. Interestingly, 3 of these peptides were derived from the 1‐8D IFN‐inducible protein 2. The 1‐8D gene, also known as IFITM2 , is a member of the 1‐8 IFN‐inducible gene family.…”

“…This family is inducible by both Type I and Type II IFNs 3, 4. We recently demonstrated that the 1‐8D gene is overexpressed in human colon cancer samples 2. In addition, the expression of several members of the IFITM family was upregulated in early and late intestinal neoplasms of mice and humans 5.…”