The peach latent mosaic viroid (PLMVd) is a small, circular RNA species that has been shown to induce RNA silencing in plants. With the goal of better understanding the biological mechanism underlying this process, the siRNAs found in PLMVd infected peach leaves were isolated and sequenced. Analysis of the resulting data prompted several conclusions, including: i. PLMVd strands of both polarities are substrates for the Dicer-like enzymes found in peach leaves; ii. the more highly structured regions of PLMVd trigger the activity of the Dicer-like enzymes; and, iii. the circular PLMVd conformers appear to be favored for transport into the cytoplasm.
Nucleotide sequences of a broad range of Peach Latent Mosaic Viroid (PLMVd) variants were determined. The variants were isolated from peach, pear, and almond tree samples collected in Tunisia. Sequence analysis confirmed the high variability of PLMVd, as no less than 119 new variants were identified. Variations included new polymorphic positions, insertions of 11 to 14 nucleotides, and new mutations within the hammerhead self-cleavage motifs. We provide the first covariation-based evidence for certain stems within the proposed secondary structure. Our covariation analysis also strengthens the view that a pseudoknot closes the replication domain. On the basis of phylogenetic tree studies and informative positions, PLMVd variants are proposed to cluster into groups and subgroups likely to have resulted from recombination events. PLMVd thus emerges as a suitable viroid for retracing the evolution of an RNA genome.
A reverse transcription polymerase chain reaction was developed to investigate the occurrence of Ôpeach latent mosaic viroidÕ (PLMVd), Ôpear blister canker viroidÕ (PBCVd), Ôhop stunt viroidÕ (HSVd) and Ôapple scar skin viroidÕ (ASSVd) on fruit trees (peach, pear, almond and apple) in Tunisia. The test was initially performed with total RNA preparations from selected isolates and then applied to total RNA preparations from leaf or bark tissues of fruit trees collected in the north of Tunisia and the Sahel. PLMVd was found to occur in peach and pear trees, HSVd in pear, peach and almond trees, and PBCVd in pear trees. Mixed PBCVd-HSVd and PLMVd-HSVd infections occurred naturally in pear trees. ASSVd was not detected in any samples from apple trees. The identity of the detected viroids was confirmed by comparing their sequences with those of other previously characterized isolates. The test was then simplified by direct use of diluted crude plant extracts. The results obtained from crude sap extracts of leaves or bark tissues and from total RNA preparations were identical. This improved test is thus quick and useful for large-scale routine analysis. It can be used in a certification programme to contribute to prevention of the occurrence and spread of PLMVd, HSVd, PBCVd and ASSVd in Tunisia.
Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.
The presence of Peach latent mosaic viroid (PLMVd) was monitored during 2 years in peach orchards located in the North of Tunisia. PLMVd population was surveyed using a specific RT-PCR test adapted to crude sap extract. During the first year (2004), 228 samples were randomly selected in 22 peach orchards (eight cultivars) and tested for the presence of PLMVd. Results showed that PLMVd is highly and equally present in four regions of the North of Tunisia. Analyses of some key factors in relation to PLMVd incidence revealed that the tree age did not influence the infection rate. The eight studied cultivars were clustered in three groups according to their PLMVd incidence. Furthermore, the early and season cultivars were statistically more infected than the late cultivars. Prospections in May and October 2005 were performed in four selected orchards. Each two orchards contained Early May Crest (early cultivar) and Carnival (late cultivar) cultivars, respectively. The difference in PLMVd incidence observed in 2004 was confirmed. Furthermore, no correlation between the tree physiological state and the viroid detection was observed. Further investigations on the origin of the differences in PLMVd incidence between Early May Crest and Carnival cultivars would be of interest.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.