Cyclophilins are a subgroup of highly conserved protein family immunophilins which are peptidyl-prolyl isomerases that interconvert between the cis and trans positions. They can act as chaperones in maintaining conformational quality control of proteomes. They are structurally conserved throughout evolution and have been found in mammals, plants, insects, fungi, and bacteria. They share a common fold architecture consisting of 8 antiparallel beta sheets and two alpha helices that pack against the sheets. They exist in the cellular compartment of most tissues and encode special functions. Intracellular Cyclophilins are secreted from cells in response to inflammatory stimuli and can mediate intercellular communication. Pro-inflammatory signals may be stimulated by extracellular Cyclophilin. Overexpression of Cyclophilins can contribute to pathological conditions. Cyclophilins are involved in the pathogenesis of viral infection, neurodegenerative diseases, ageing and cancer. Exhibiting several molecular functions, Cyclophilins can bind to cyclosporine and calcium-dependent ser/thr Calcineurin and has been used to describe the immunosuppressive action of cyclosporine. Cyclophilin can stabilize the cis-trans conformation transition state and speed up isomerization steps in protein folding. This process is important in the assembly of multiple domain proteins. Their existence as foldases and molecular chaperones enable them to be able to assist in the covalent folding or unfolding and the assembly or disassembly of other macromolecular structures.
MXenes have shown great potential in a variety of domains. This review elaborates the up-to-date synthesis methods, physicochemical properties and biological applications of MXene-based nanocomposites, as well as the practical hurdles and prospects.
The emergence of the novel coronavirus (SARS-CoV-2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS-CoV-2, a class I fusion protein that aids ACE2 (angiotensin-converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication-defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole-inactivated SARS-CoV-2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA-based) vaccine candidate. The "YLQPRTFLL" peptide sequence (position 269-277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A-0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll-like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence "UACCUGCAGCCGCGUACCUUCCUGCUG" exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS-CoV-2 infection.
The inactivation of p53 in tumor cells is as a result of the deletion or mutation of the TP3 gene, while the inhibition of its activity is by interaction with overexpressed mouse double minute 2 (MDM2). Small‐molecule inhibitors that target the interaction between p53 and MDM2 are now being pursued as potential therapeutic agents for cancer therapy. To date, many small‐molecule inhibitors of the p53‐MDM2 interaction have been identified which, however, possess toxicity, bioavailability and/or drug resistance limitations. In this study, we directed a ligand‐based pharmacophore modeling protocol towards the search of novel inhibitors of the p53‐MDM2 interaction. Generated pharmacophore features from known and novel inhibitors of the p53‐MDM2 interaction were used in searching the ZINC database for drug‐like molecules. With stringent search parameters set, we generated a ligand library of 7000 ZINC compounds and a sub‐library of 907 compounds from the Selleckchem's “Apoptosis Compound Library”. Upon the docking of both compound libraries to the target receptor, the resulting top 100 binders were subjected to in silico ADMET screening, out of which the top 3 compounds with the most favorable properties (ZINC71932671, ZINC02375540 and ZINC08870467) were selected for further assessment. These 3 hits also displayed favorable interactions with important residues involved in the p53‐MDM2 protein‐protein interaction, while the molecular dynamics simulation study suggest a stable conformation for the protein‐ligand complexes. These three compounds can be used in the development of potential cancer therapeutics that are targeted at restoring the function of p53 by blocking its interaction with MDM2.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.