Yes-Associated Protein Up-regulates Jagged-1 and Activates the NOTCH Pathway in Human Hepatocellular Carcinoma

Abstract

Background & Aims Cancer cells often lose contact inhibition to undergo anchorage-independent proliferation and become resistant to apoptosis by inactivating the Hippo signaling pathway, resulting in activation of the transcriptional co-activator yes-associated protein (YAP). However, the oncogenic mechanisms of YAP are unclear. Methods Using cross-species analysis of expression data, the Notch ligand Jagged-1 (Jag-1) was identified as downstream target of YAP in hepatocytes and hepatocellular carcinoma (HCC) cells. We analyzed the functions of YAP in HCC cells via overexpression and RNA silencing experiments. We used transgenic mice that overexpressed a constitutively activated form of YAP (YAPS127A), and measured protein levels in HCC and colorectal and pancreatic tumor samples from patients. Results Human HCC cell lines and mouse hepatocytes that overexpress YAPS127A upregulated Jag-1, leading to activation of the Notch pathway and increased proliferation. Induction of Jag-1, activation of Notch, and cell proliferation required binding of YAP to its transcriptional partner TEAD4; TEAD4 binding required Mst1/2, but not WNT-β-catenin signaling. Levels of YAP correlated with Jag-1 expression and Notch signaling in human tumor samples and shorter survival times of patients with HCC or colorectal cancer. Conclusion The transcriptional regulator YAP upregulates Jag-1 to activate Notch signaling in HCC cells and mouse hepatocytes. YAP-dependent activity of Jag-1 and Notch correlate in human HCC and colorectal tumor samples with patient survival times, suggesting the use of YAP and Notch inhibitors as therapeutics for gastrointestinal cancer.

Dysregulated YAP1/TAZ and TGF-β signaling mediate hepatocarcinogenesis in Mob1a/1b -deficient mice

“…These data indicate that MOB1A/1B maintain oval cell quiescence and function as potent tumor suppressors in the liver. The liver phenotypes of LMob1DKO mice are more dramatic than those of mice with liver-specific mutations of Nf2 (14) effects than TEAD2/3 on transcriptional targets in human liver cells (12). Finally, we have demonstrated that TAZ and TGF-β2/3 are also critical Hippo signaling effectors whose loss mitigates the liver phenotypes of LMob1DKO mice.…”

“…preventing it from activating TEA domain family member (TEAD)-mediated transcription of connective tissue growth factor (CTGF) (9), secreted phosphoprotein 1 (SPP1) (10), transforming growth factor beta (TGFβ) (11), and Jagged 1 (JAG1) (12). Phosphorylated YAP1/TAZ also binds to E3-ubiquitin ligase SCF βTRCP and is degraded (13).…”

MEK1 promotes YAP and their interaction is critical for tumorigenesis in liver cancer

“…Cells were treated by PD98059 (15-50 lM, Cell Signaling Technology (CST), Boston, MA, USA) or U0126 (1)(2)(3)(4)(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20) lM, CST) 24 h before harvest. ShRNAs were cloned into pLKO.1 lentiviral vectors using primers as follows: MEK1-sh#1-Forward: CCGGAACTCTGGATCAAGTCCTGAACTCGAGTTCAGGACTTGATCCA-GAGTTTTTTTG and Reward: AATTCAAAAAAACTCTGGATCAAGTC C TGAACTCGAGTTCAGGACTTGATCCAGAGTT; MEK1-sh#2-Forward: CCGGAAGGACTCATTACTCTGTGCACTCGAGTGCACAGAGTAATGAGT CCTTTTTTTG and Reward: AATTCAAAAAAAGGACTCATTACTCTG TGCACTCGAGTGCACAGAGTAATGAGTCCTT.…”

“…By using cross-species analysis of expression data, the Notch ligand Jagged-1 (Jag-1) was identified as a downstream target of YAP in HCC cells. Overexpression of YAP upregulates Jag-1, leading to activation of Notch pathway and increased proliferation [6]. Having an essential role in cellular growth, knockout of the YAP gene in mice could lead to early embryonic lethality [7].…”

« Le monde selon YAP »

“…Les mécanismes par lesquels YAP exerce ces propriétés oncogéniques dans le foie ne sont pas encore parfaitement compris. Une hypothèse récente suggère que YAP augmenterait l'expression de Jag-1, activant la voie Notch dans les hépatocytes et les lignées tumorales de CHC, mais de façon indépendante de la β-caténine [25]. Un mécanisme similaire est également décrit dans l'intestin, puisqu'un inhibiteur de Notch restreint la dysplasie intestinale induite par YAP [18].…”