Wolbachia-induced paternal defect in Drosophila is likely by interaction with the juvenile hormone pathway

Liu, Chen; Wang, Jialin; Zheng, Yan; Xiong, Erhui; Li, Jingjing; Yuan, Lin-Ling; Yu, Xiao‐Qiang; Wang, Yufeng

doi:10.1016/j.ibmb.2014.03.014

Cited by 61 publications

(82 citation statements)

References 59 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Both w Mel and w MelPop infect neural tissues [15, 17], and w MelPop has a pronounced effect, causing neurological degradation in Drosophila melanogaster [84]. Wolbachia also affect hormone levels and contribute to host behavioural changes [85–87]. The overall physiological effect of w Flu infection is unclear, however given that genes involved in neurological development, signalling and neurotransmitter trafficking and release were all upregulated by w Flu, there could be critical effects.…”

Section: Resultsmentioning

confidence: 99%

The transcriptome of the mosquito Aedes fluviatilis (Diptera: Culicidae), and transcriptional changes associated with its native Wolbachia infection

Caragata¹,

Pais

Baton³

et al. 2017

BMC Genomics

View full text Add to dashboard Cite

Background Wolbachia is a bacterial endosymbiont that naturally infects a wide range of insect species, and causes drastic changes to host biology. Stable infections of Wolbachia in mosquitoes can inhibit infection with medically important pathogens such as dengue virus and malaria-causing Plasmodium parasites. However, some native Wolbachia strains can enhance infection with certain pathogens, as is the case for the mosquito Aedes fluviatilis, where infection with Plasmodium gallinaceum is enhanced by the native wFlu Wolbachia strain. To better understand the biological interactions between mosquitoes and native Wolbachia infections, and to investigate the process of pathogen enhancement, we used RNA-Seq to generate the transcriptome of Ae. fluviatilis with and without Wolbachia infection.ResultsIn total, we generated 22,280,160 Illumina paired-end reads from Wolbachia-infected and uninfected mosquitoes, and used these to make a de novo transcriptome assembly, resulting in 58,013 contigs with a median sequence length of 443 bp and an N50 of 2454 bp. Contigs were annotated through local alignments using BlastX, and associated with both gene ontology and KEGG orthology terms. Through baySeq, we identified 159 contigs that were significantly upregulated due to Wolbachia infection, and 98 that were downregulated. Critically, we saw no changes to Toll or IMD immune gene transcription, but did see evidence that wFlu infection altered the expression of several bacterial recognition genes, and immune-related genes that could influence Plasmodium infection. wFlu infection also had a widespread effect on a number of host physiological processes including protein, carbohydrate and lipid metabolism, and oxidative stress. We then compared our data set with transcriptomic data for other Wolbachia infections in Aedes aegypti, and identified a core set of 15 gene groups associated with Wolbachia infection in mosquitoes.ConclusionsWhile the scale of transcriptional changes associated with wFlu infection might be small, the scope is rather large, which confirms that native Wolbachia infections maintain intricate molecular relationships with their mosquito hosts even after lengthy periods of co-evolution. We have also identified several potential means through which wFlu infection might influence Plasmodium infection in Ae. fluviatilis, and these genes should form the basis of future investigation into the enhancement of Plasmodium by Wolbachia.Electronic supplementary materialThe online version of this article (doi:10.1186/s12864-016-3441-4) contains supplementary material, which is available to authorized users.

show abstract

Section: Resultsmentioning

confidence: 99%

The transcriptome of the mosquito Aedes fluviatilis (Diptera: Culicidae), and transcriptional changes associated with its native Wolbachia infection

Caragata¹,

Pais

Baton³

et al. 2017

BMC Genomics

View full text Add to dashboard Cite

show abstract

“…Special primers were designed, based on FlyBase for ATPsyn‐b and the reference gene rp49 as follows: ATPsyn‐b ‐F: 5′‐CTGATCACCTATCTCTGCTC‐3′, ATPsyn‐b ‐R: 5′‐TCGATTTTATCGATCTCGCC‐3′; rp‐49 ‐F: 5′‐CGGTTACGGATCGAACAAGC‐3′, rp‐49 ‐R: 5′‐CTTGCGCTTCTTGGAGGAGA‐3′. The primers for JhI‐26 gene are as described in Liu et al (). Quantitative PCR (QPCR) was performed using a Miniopticon system (BioRad) with a Platinum SYBR Green qPCR SuperMix (Transgene).…”

Section: Methodsmentioning

confidence: 99%

KNOCKDOWN OF ATPsyn‐b CAUSED LARVAL GROWTH DEFECT AND MALE INFERTILITY IN Drosophila

Chen

Zheng

et al. 2014

Arch Insect Biochem Physiol

Self Cite

View full text Add to dashboard Cite

The ATPsyn-b encoding for subunit b of ATP synthase in Drosophila melanogaster is proposed to act in ATP synthesis and phagocytosis, and has been identified as one of the sperm proteins in both Drosophila and mammals. At present, its details of functions in animal growth and spermatogenesis have not been reported. In this study, we knocked down ATPsyn-b using Drosophila lines expressing inducible hairpin RNAi constructs and Gal4 drivers. Ubiquitous knockdown of ATPsyn-b resulted in growth defects in larval stage as the larvae did not grow bigger than the size of normal second-instar larvae. Knockdown in testes did not interrupt the developmental excursion to viable adult flies, however, these male adults were sterile. Analyses of testes revealed disrupted nuclear bundles during spermatogenesis and abnormal shaping in spermatid elongation. There were no mature sperm in the seminal vesicle of ATPsyn-b knockdown male testes. These findings suggest us that ATPsyn-b acts in growth and male fertility of Drosophila.

show abstract

“…Mechanisms proposed for maternal effects in insects include differences in resource allocation and nutrient provisioning to offspring (Bonduriansky and Day 2009, Lyko et al 2010, Newcombe et al 2013, transfer of symbionts or hormones (Fox et al 1997, Koehler and Kaltenpoth 2013, Liu et al 2014, and changes in the epigenome (Chittka andChittka 2010, Oppold et al 2015). High and low larval food offspring development and survival were both reduced in treatments with two high food parents (H♀H♂-high and H♀H♂-low) relative to treatments with low larval food mothers mated with high larval food fathers (L♀H♂-high and L♀H♂-low).…”

Section: Maternal Effectsmentioning

confidence: 99%

Maternal and paternal nutrition in a mosquito influences offspring life histories but not infection with an arbovirus

Zirbel

Alto

2018

Ecosphere

View full text Add to dashboard Cite

Citation: Zirbel, K. E., and B. W. Alto. 2018. Maternal and paternal nutrition in a mosquito influences offspring life histories but not infection with an arbovirus. Ecosphere 9(10):Abstract. The nutritional ecology of an organism can influence the phenotypes of its offspring, generating maternal effects (when derived from mothers) and paternal effects (when derived from fathers). Given the importance of larval nutrition in influencing adult life histories and vector competence in Aedes aegypti, we considered how maternal and paternal nutrition influences offspring. Parental generation females and males were reared on either high or low larval food and mated in four sex-by-parental diet crosses. Offspring traits measured included development time, survivorship, female size, susceptibility to infection with dengue virus, viral titer, and viral dissemination. We found evidence for both maternal and paternal effects on life history traits (with female development time contributing most to this effect), but not viral traits. These results were only evident when mothers mated with high larval food fathers and when fathers mated with high larval food mothers. Offspring from dissimilar nutrient condition parents developed more quickly than offspring from other parental crosses. Overall, results suggest that parental effects in Ae. aegypti are conditionally derived from both the maternal and paternal environment.

show abstract

Wolbachia-induced paternal defect in Drosophila is likely by interaction with the juvenile hormone pathway

Cited by 61 publications

References 59 publications

The transcriptome of the mosquito Aedes fluviatilis (Diptera: Culicidae), and transcriptional changes associated with its native Wolbachia infection

The transcriptome of the mosquito Aedes fluviatilis (Diptera: Culicidae), and transcriptional changes associated with its native Wolbachia infection

KNOCKDOWN OF ATPsyn‐b CAUSED LARVAL GROWTH DEFECT AND MALE INFERTILITY IN Drosophila

Maternal and paternal nutrition in a mosquito influences offspring life histories but not infection with an arbovirus

Contact Info

Product

Resources

About