Visualising individual sequence-specific protein–DNA interactions in situ

Weibrecht, Irene; Gavrilović, Milan; Lindbom, Lena; Landegren, Ulf; Wählby, Carolina; Söderberg, Ola

doi:10.1016/j.nbt.2011.08.002

Cited by 32 publications

(22 citation statements)

References 20 publications

(28 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Combined analysis of all trans -regulated genes validated the core motif CACGCCTGTAATCCCAGCACTTTGG (Figure 4A). The identified motif is an Alu-DEIN element [32], [33] with approximately 60.000 copies per human genome [34]. Since MEME does not provide information whether a motif is enriched or depleted, we quantitatively tested motif occurrence and found a significant depletion in up- and down-regulated genes compared to genes not regulated by ANRIL over-expression (4 vs. 6 occurrences per 5 kb promoter, respectively, P <10 −15 ; Figure 4B).…”

Section: Resultsmentioning

confidence: 99%

Alu Elements in ANRIL Non-Coding RNA at Chromosome 9p21 Modulate Atherogenic Cell Functions through Trans-Regulation of Gene Networks

et al. 2013

View full text Add to dashboard Cite

The chromosome 9p21 (Chr9p21) locus of coronary artery disease has been identified in the first surge of genome-wide association and is the strongest genetic factor of atherosclerosis known today. Chr9p21 encodes the long non-coding RNA (ncRNA) antisense non-coding RNA in the INK4 locus (ANRIL). ANRIL expression is associated with the Chr9p21 genotype and correlated with atherosclerosis severity. Here, we report on the molecular mechanisms through which ANRIL regulates target-genes in trans, leading to increased cell proliferation, increased cell adhesion and decreased apoptosis, which are all essential mechanisms of atherogenesis. Importantly, trans-regulation was dependent on Alu motifs, which marked the promoters of ANRIL target genes and were mirrored in ANRIL RNA transcripts. ANRIL bound Polycomb group proteins that were highly enriched in the proximity of Alu motifs across the genome and were recruited to promoters of target genes upon ANRIL over-expression. The functional relevance of Alu motifs in ANRIL was confirmed by deletion and mutagenesis, reversing trans-regulation and atherogenic cell functions. ANRIL-regulated networks were confirmed in 2280 individuals with and without coronary artery disease and functionally validated in primary cells from patients carrying the Chr9p21 risk allele. Our study provides a molecular mechanism for pro-atherogenic effects of ANRIL at Chr9p21 and suggests a novel role for Alu elements in epigenetic gene regulation by long ncRNAs.

show abstract

Section: Resultsmentioning

confidence: 99%

Alu Elements in ANRIL Non-Coding RNA at Chromosome 9p21 Modulate Atherogenic Cell Functions through Trans-Regulation of Gene Networks

et al. 2013

View full text Add to dashboard Cite

show abstract

“…First, although several groups 29, 30 have employed PLA to detect protein-nucleic acid interactions in vitro , our studies are the first to our knowledge to describe a method that permits detection of specific histone modifications at a given gene locus in single cells in fixed histological specimens which we believe will have tremendous utility for investigating the role of epigenetic changes in development and disease. Indeed, there is a large body of research that have investigated the role of epigenetic regulation and chromatin signature during stem cell differentiation or development of specific types of cancer 31 .…”

Section: Discussionmentioning

confidence: 99%

Detection of histone modifications at specific gene loci in single cells in histological sections

et al. 2013

View full text Add to dashboard Cite

Chromatin immunoprecipitation (ChIP) assays have contributed greatly to our understanding of the role of histone modifications in gene regulation. However, a major limitation is that they do not permit analysis with single cell resolution thus confounding analyses of heterogeneous cell populations. Herein we present a new method which permits visualization of histone modifications of single genomic loci with single-cell resolution in formaldehyde-fixed paraffin-embedded tissue sections based on combined use of In Situ Hybridization (ISH) and Proximity Ligation Assays (PLA). Using this method we show that H3K4dime of the MYH11 locus is restricted to the smooth muscle cell (SMC) lineage in human and mouse tissue sections, and that the mark persists even in phenotypically modulated SMC within atherosclerotic lesions that show no detectable expression of SMC marker genes. This new methodology has promise for broad applications in the study of epigenetic mechanisms in complex multicellular tissues in development and disease.

show abstract

“…1), but other designs could be used that would allow detection of all pairwise combinations by including a detection tag in both PLA probes (supplemental Fig. 15) and assay for double-labeled RCA products (25). Multiplex assays generally save time and effort and, where applicable, precious clinical material, while providing opportunities for internally controlled reactions.…”

Section: Discussionmentioning

confidence: 99%

Parallel Visualization of Multiple Protein Complexes in Individual Cells in Tumor Tissue

Leuchowius

Clausson

Grannas

et al. 2013

Molecular & Cellular Proteomics

Self Cite

View full text Add to dashboard Cite

Cellular functions are regulated and executed by complex protein interaction networks. Accordingly, it is essential to understand the interplay between proteins in determining the activity status of signaling cascades. New methods are therefore required to provide information on different protein interaction events at the single cell level in heterogeneous cell populations such as in tissue sections. Here, we describe a multiplex proximity ligation assay for simultaneous visualization of multiple protein complexes in situ. The assay is an enhancement of the original proximity ligation assay, and it is based on using proximity probes labeled with unique tag sequences that can be used to read out which probes, from a pool of probes, have bound a certain protein complex. Using this approach, it is possible to gain information on the constituents of different protein complexes, the subcellular location of the complexes, and how the balance between different complex constituents can change between normal and malignant cells, for example. As a proof of concept, we used the assay to simultaneously visualize multiple protein complexes involving EGFR, HER2, and HER3 homo-and heterodimers on a single-cell level in breast cancer tissue sections. The ability to study several protein complex formations concurrently at single cell resolution could be of great potential for a systems understanding, paving the way for improved disease diagnostics and possibilities for drug development. Molecular & Cellular

show abstract

Visualising individual sequence-specific protein–DNA interactions in situ

Cited by 32 publications

References 20 publications

Alu Elements in ANRIL Non-Coding RNA at Chromosome 9p21 Modulate Atherogenic Cell Functions through Trans-Regulation of Gene Networks

Alu Elements in ANRIL Non-Coding RNA at Chromosome 9p21 Modulate Atherogenic Cell Functions through Trans-Regulation of Gene Networks

Detection of histone modifications at specific gene loci in single cells in histological sections

Parallel Visualization of Multiple Protein Complexes in Individual Cells in Tumor Tissue

Contact Info

Product

Resources

About