Upregulation of miR-330-5p is associated with carotid plaque’s stability by targeting Talin-1 in symptomatic carotid stenosis patients

Abstract

Background The aim of this study was to investigate the relationship between Talin-1 and stability of carotid atherosclerosis plaque and also find out the role of miRNA, as an upstream regulator, in regulating the expression level of Talin-1. Methods Human carotid plaques were obtained from 20 symptomatic carotid stenosis patients who underwent carotid endarterectomy (CEA) in our hospital between October 2014 and August 2017. Western blot analysis and immunohistochemistry was carried out to detect the distribution and expression level of Talin-1 in each plaque sample. The content of miRNAs in carotid plaque was decected by quantitative reverse transcription polymerase chain reaction (RT-qPCR), and the relative expression levels were calculated by 2 -△△Ct method after the (cycle threshold) Ct value (power amplification knee point) was obtained. Dual-luciferase reporter assays were applied to verify the successful transfections. Finally, we compared all the groups with independent-samples t-test and one-way analysis of variance (ANOVA). Results Talin-1 was significantly downregulated in human unstable carotid plaque samples compared with stable carotid plaques ( P < 0.05), and the distribution of Talin-1 was mainly found in the fibrous cap of carotid plaque. The overexpression of miRNA-330-5p was found in unstable carotid plaque, which significantly induced the inhibition of expression level of Talin-1. Conclusion Upregulated miR-330-5p may lead to unstable carotid plaques by targeting Talin-1 in symptomatic carotid stenosis patients. This might be a new target for the treatment of atherosclerotic diseases through future studies.

The potential of microRNA‐126 in predicting disease risk, mortality of sepsis, and its correlation with inflammation and sepsis severity

“…Afterward, PCR was conducted by SYBR Premix Ex Taq Reagent (Takara) using U6 as the internal reference. The relative expression of miR‐126 was calculated by 2 −△△Ct method 13 . The primers used were as follows: miR‐126 forward primer: 5′‐ACACTCCAGCTGGGCATTATTACTTTTGGTAC‐3′; reverse primer: 5′‐ACACTCCAGCTGGGACTGCAGTGAAGGCACTT‐3′; U6 forward primer: 5′‐CTCGCTTCGGCAGCACATATACTA‐3′; reverse primer: 5′‐ACGAATTTGCGTGTCATCCTTGC‐3′.…”

LINC01123 Promotes the Proliferation and Migration of Vascular Smooth Muscle Cells and Alleviates Carotid Atherosclerosis by Modulating miR-1277-5p/KLF5

“…miR-126-5p promotes endothelial cell proliferation and curbs the progression of AS through suppressing Dlk1 [25]. Up-regulated miR-330-5p is connected to the stability of carotid plaque via targeting Talin-1 [26].…”

High Plasma Levels of Soluble Talin-1 in Patients with Coronary Artery Disease

“…These findings thus suggest that talin-1 would be downregulated in atherosclerotic plaques. Furthermore, talin-1 was reported to be downregulated in unstable carotid plaques compared with stable plaques [9]. The overexpression of microRNA-330-5p was also demonstrated in unstable plaques, which significantly downregulated talin-1 [9].…”

“…Furthermore, talin-1 was reported to be downregulated in unstable carotid plaques compared with stable plaques [9]. The overexpression of microRNA-330-5p was also demonstrated in unstable plaques, which significantly downregulated talin-1 [9]. In contrast, high TLN1 expression along with low microRNA-330-5p expression was reported in hepatocellular cancer tissues [19].…”

“…They suggested that talin-1 downregulation causes the loosening of cell-ECM interactions, thereby leading to the injury and disintegration of vascular walls in atherosclerosis. Furthermore, talin-1 was shown to be downregulated in unstable carotid plaques compared with stable plaques [9]. Moreover, talin-1 was shown to be downregulated in the media of aortic samples from 10 patients with aortic dissection [10].…”