Unexpected prey of juvenile spotted scat (<i>Scatophagus argus</i>) near a wharf: The prevalence of fouling organisms in stomach contents

Lin, Xianzhi; Hu, Shineng; Liu, Sheng; Huang, Hui

doi:10.1002/ece3.4380

Cited by 10 publications

(13 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…By using metabarcoding technology, we were able to elucidate crane diets at greater detail than previously known. The improved knowledge might be due to the ability of metabarcoding to provide a more comprehensive perspective and more details on food sources than traditional methods [ 66 , 67 , 80 ]. Metabarcoding is able to detect a variety of smaller and softer bodied food items that are overlooked by microhistological methods [ 67 , 80 ].…”

Section: Discussionmentioning

confidence: 99%

“…The improved knowledge might be due to the ability of metabarcoding to provide a more comprehensive perspective and more details on food sources than traditional methods [ 66 , 67 , 80 ]. Metabarcoding is able to detect a variety of smaller and softer bodied food items that are overlooked by microhistological methods [ 67 , 80 ]. It also enables the identification of food items at a higher taxonomic resolution [ 69 , 81 ].…”

Section: Discussionmentioning

confidence: 99%

“…Traditional dietary analysis methods include direct observation of foraging animals and microscopic examination of feces or gut contents. While these approaches have been suggested to be useful in some cases, they also exhibit methodological limitations [65][66][67]. The main drawbacks are that the methods can be inaccurate and labor-intensive [65,68].…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Influences of submerged plant collapse on diet composition, breadth, and overlap among four crane species at Poyang Lake, China

Hou

Wang

et al. 2021

Front Zool

View full text Add to dashboard Cite

Background Interannual variation in resource abundance has become more unpredictable, and food shortages have increasingly occurred in the recent decades. However, compared to seasonal fluctuations in resource abundance, the influences of interannual variation in resource abundance on the dietary niches of consumers remain poorly understood. Poyang Lake, China, is a very important wintering ground for the globally endangered Siberian Crane (Leucogeranus leucogeranus), White-naped Crane (Grus vipio), and Hooded Crane (G. monacha), as well as the non-endangered Eurasian Crane (G. grus). Tubers of Vallisneria spp., the dominant submerged macrophytes at Poyang Lake, is an important food for cranes. Nevertheless, submerged macrophytes have experienced serious degradation recently. In this study, we used metabarcoding technology to explore the consequences of Vallisneria tuber collapse on the diet compositions, breadths, and overlaps of the four crane species based on fecal samples collected in winter 2017 (a year with tuber collapse) and winter 2018 (a year with high tuber abundance). Results Compared to previous studies, our study elucidates crane diets in an unprecedented level of detail. Vallisneria tubers was confirmed as an important food source of cranes. Surprisingly, the grassland plant Polygonum criopolitanum was also found to be an important food source in the feces of cranes. Agricultural fields were important foraging sites for Siberian Cranes, White-naped Cranes, and Hooded Cranes, providing foods that allowed them to survive in winters with natural food shortages. However, the three crane species preferred natural wetlands to agricultural fields when the abundance of natural foods was high. The abundance of Vallisneria tubers, and probably P. criopolitanum, greatly influenced the dietary compositions, breadths and overlap of cranes. During periods of preferred resource shortage, White-naped Cranes and Hooded Cranes widened their dietary niches, while Siberian Cranes maintained a stable niche width. The dietary niche overlap among crane species increased substantially under conditions of plentiful preferred food resources. Conclusions Our study emphasizes the superior quality of natural wetlands compared to agricultural fields as foraging habitats for cranes. To provide safer and better foraging areas for cranes, it is urgent to restore the submerged plants at Poyang Lake. While high dietary niche overlap is often interpreted as intense interspecific competition, our study highlights the importance of taking food abundance into account.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Influences of submerged plant collapse on diet composition, breadth, and overlap among four crane species at Poyang Lake, China

Hou

Wang

et al. 2021

Front Zool

View full text Add to dashboard Cite

show abstract

“…Mitochondrial D‐LOOP sequences were amplified from the DNA samples using nested polymerase chain reactions (PCRs) with four primers that were designed using the Primer Premier software (version 5.0; Lin et al., 2018): F1 (5ʹ‐TTAAAGCATCGGTCTTGTAA‐3ʹ), R1 (5ʹ‐ATAGTGGGGTATCTAATCCCAGTT‐3ʹ), F2 (5ʹ‐AGCACCGGTCTTGTAAACCG‐3ʹ), and R2 (5ʹ‐GGTGCGGRKACTTGCATGTRTAA‐3ʹ). The first PCR (10.0 μl) contained 5 μl 2× Ex Taq Mastermix Bufffer, 0.4 μl of upstream primer (F1; 10 µM), 0.4 μl of the downstream primer (R1; 10 µM), 0.4 μl of DNA template (100 ng/µl), and sufficient ddH 2 O to total 10.0 μl.…”

Section: Methodsmentioning

confidence: 99%

“…Mitochondrial D-LOOP sequences were amplified from the DNA samples using nested polymerase chain reactions (PCRs) with four primers that were designed using the Primer Premier software (version 5.0; Lin et al, 2018)…”

Section: Dna Extraction Polymerase Chain Reaction and Sequencingmentioning

confidence: 99%

Genetic diversity of mitochondrial D‐LOOP sequences in the spotted scat ( Scatophagus argus ) from different geographical populations along the northern coast of the South China Sea

et al. 2020

View full text Add to dashboard Cite

Summary The genetic diversity of 289 spotted scat (Scatophagus argus) from seven populations along the northern coast of the South China Sea was studied by analyzing the full‐length sequences of the mitochondrial control region (D‐LOOP). The S. argus D‐LOOP sequence was 1,004–1,010 bp long and contained 156 variant sites. The seven studied S. argus populations had a high degree of genetic diversity (haplotype diversity [Hd] = 0.99135; nucleotide diversity (π) = 0.01313). There was no obvious genetic differentiation among the seven geographical populations and gene exchange was frequent (Fst = −0.01867–0.01117, p > .05). Four distinct mitochondrial lineages were identified in the phylogenetic tree and the haplotype network. The between‐lineage Fst was 0.71690–0.84940 (p < .001), but these lineages showed no obvious phylogeographic pattern. Based on D‐LOOP mutation rates, we estimated that the four lineages diverged approximately 513,800–93,600 years ago, during the Eocene ice age, at which time falling sea levels may have led to population segregation. We estimated that S. argus population expansion occurred approximately 2.29–0.68 million years ago, during the late Pleistocene. During this period, sea levels rose again, allowing previously separated lineages to come into sympatry, which eventually gave rise to a highly genetically diverse population without pyhlogeographic structure. Here, we characterized the genetic structure and differentiation of seven S. argus populations from the northern coast of the South China Sea. Our results suggested that the seven S. argus populations from the northern coast of the South China Sea have a relatively low level of genetic variation and can be considered a single unit for the purposes of fishery development, utilization, and management.

show abstract

A multiple-methods approach to investigate dietary differences among nominally herbivorous fishes

Lin,

Hu,

Zhou

et al. 2023

Mar Biol

View full text Add to dashboard Cite

Unexpected prey of juvenile spotted scat (Scatophagus argus) near a wharf: The prevalence of fouling organisms in stomach contents

Cited by 10 publications

References 33 publications

Influences of submerged plant collapse on diet composition, breadth, and overlap among four crane species at Poyang Lake, China

Influences of submerged plant collapse on diet composition, breadth, and overlap among four crane species at Poyang Lake, China

Genetic diversity of mitochondrial D‐LOOP sequences in the spotted scat ( Scatophagus argus ) from different geographical populations along the northern coast of the South China Sea

A multiple-methods approach to investigate dietary differences among nominally herbivorous fishes

Contact Info

Product

Resources

About