Ultra-sensitive molecular MRI of cerebrovascular cell activation enables early detection of chronic central nervous system disorders

Montagne, Axel; Gauberti, Maxime; Macrez, Richard; Jullienne, A.; Briens, Aurélien; Raynaud, Jean‐Sébastien; Louin, Gaëlle; Haelewyn, Benoît; Docagne, Fabián; Defer, Gilles; Vivien, Denis; Maubert, Eric

doi:10.1016/j.neuroimage.2012.07.018

Cited by 65 publications

(103 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Reverse transcription and quantitative PCR were performed as previously described (Montagne et al, 2012). Forward (F) and reverse (R) primers were: Vcam1 (F) gaacccaaacagaggcagag, (R) tgagcaggtcaggttcacag; P-selectin (Selp) (F) ggcaagtggaatgataacc, (R) ccatagaagcctgggtagca; Gapdh (F) tgcgacttcaacagcaactc, (R) atgtaggccatgaggtccac.…”

Section: Quantitative Real-time Polymerase Chain Reaction For Vasculamentioning

confidence: 99%

“…We recently developed a new formulation of microsized particles of iron oxide (MPIO) targeted against VCAM1 to achieve ultra-sensitive molecular imaging of cerebrovascular inflammation in CNS disorders. This molecular MRI method reached unprecedented sensitivity and specificity to reveal endothelial cell activation in the brain with the possibility to reveal discrete and early stages of endothelium dysfunction (Montagne et al, 2012;Gauberti et al, 2013). Molecular imaging of cerebrovascular inflammation thus appears as an interesting target for TIA, as endothelial dysfunction is at the origin of this pathology.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Molecular magnetic resonance imaging discloses endothelial activation after transient ischaemic attack

Quenault

Lizarrondo

Etard

et al. 2016

Brain

Self Cite

View full text Add to dashboard Cite

About 20% of patients with ischaemic stroke have a preceding transient ischaemic attack, which is clinically defined as focal neurological symptoms of ischaemic origin resolving spontaneously. Failure to diagnose transient ischaemic attack is a wasted opportunity to prevent recurrent disabling stroke. Unfortunately, diagnosis can be difficult, due to numerous mimics, and to the absence of a specific test. New diagnostic tools are thus needed, in particular for radiologically silent cases, which correspond to the recommended tissue-based definition of transient ischaemic attack. As endothelial activation is a hallmark of cerebrovascular events, we postulated that this may also be true for transient ischaemic attack, and that it would be clinically relevant to develop non-invasive in vivo imaging to detect this endothelial activation. Using transcriptional and immunohistological analyses for adhesion molecules in a mouse model, we identified brain endothelial P-selectin as a potential biomarker for transient ischaemic attack. We thus developed ultra-sensitive molecular magnetic resonance imaging using antibody-based microparticles of iron oxide targeting P-selectin. This highly sensitive imaging strategy unmasked activated endothelial cells after experimental transient ischaemic attack and allowed discriminating transient ischaemic attack from epilepsy and migraine, two important transient ischaemic attack mimics. We provide preclinical evidence that combining conventional magnetic resonance imaging with molecular magnetic resonance imaging targeting P-selectin might aid in the diagnosis of transient ischaemic attack.

show abstract

Section: Quantitative Real-time Polymerase Chain Reaction For Vasculamentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Molecular magnetic resonance imaging discloses endothelial activation after transient ischaemic attack

Quenault

Lizarrondo

Etard

et al. 2016

Brain

Self Cite

View full text Add to dashboard Cite

show abstract

“…8,9 We recently developed an original contrast agent targeting the vascular cell adhesion molecule-1 (VCAM-1), which displays all the required characteristics of an ideal imaging agent, thus allowing a rapid and sensitive assessment of the early stages of the inflammatory reaction. 10 In the present study, we investigated the efficiency of these microsized particles of iron oxide targeting VCAM-1 (MPIOs-αVCAM-1) to monitor cerebrovascular inflammation and evaluate the response to anti-inflammatory treatments after ischemic and hemorrhagic strokes.…”

mentioning

confidence: 99%

Ultra-Sensitive Molecular MRI of Vascular Cell Adhesion Molecule-1 Reveals a Dynamic Inflammatory Penumbra After Strokes

Gauberti

Montagne

Marcos‐Contreras

et al. 2013

Stroke

Self Cite

110

View full text Add to dashboard Cite

Background and Purpose-Our aim was to assess the spatiotemporal evolution of the cerebrovascular inflammation occurring after ischemic and hemorrhagic strokes using a recently developed, fast, and ultra-sensitive molecular MRI method. Methods-We first assessed longitudinally the cerebrovascular inflammation triggered by collagenase-induced hemorrhage and by permanent/transient middle cerebral artery occlusion in mice, using MRI after injection of microparticles of iron oxide targeted to vascular cell adhesion molecule-1 (MPIOs-αVCAM-1). Thereafter, we used this method to study the anti-inflammatory effects of celecoxib, atorvastatin, and dipyridamole after stroke. Results-Using multiparametric MRI, we demonstrated that the level and the kinetics of cerebrovascular VCAM-1 expression depend on several parameters, including stroke pathogenesis, the natural history of the disease, and the administration of inflammation-modulating drugs. Interestingly, in transient middle cerebral artery occlusion and intracranial hemorrhage models, VCAM-1 expression was maximal at 24 hours and almost returned to baseline 5 days after stroke onset. In contrast, after permanent middle cerebral artery occlusion, VCAM-1 overexpression was sustained between 24 hours and 5 days, and was particularly significant in the peri-infarct areas. Our results suggest that these perilesional areas expressing VCAM-1 constitute an inflammatory penumbra that is recruited by the ischemic core during the subacute phase. Using MPIOs-αVCAM-1-enhanced imaging, we also provided evidence that celecoxib and atorvastatin (but not dipyridamole) alleviate VCAM-1 overexpression after stroke and prevent formation of the inflammatory penumbra. Conclusions-MPIOs-αVCAM-1-enhanced imaging seems to be promising in the detection of individuals presenting with severe cerebrovascular responses after stroke, which could therefore benefit from anti-inflammatory treatments.

show abstract

“…7,8 Briefly, mice underwent NBO preparation during 30 minutes. Thereafter, mice received intravenous microparticles of iron oxide targeting vascular cell adhesion molecule-1 (MPIO-αVCAM-1) (1 mg/kg) 24 hours after ICH onset (collagenase model).…”

Section: Molecular Mrimentioning

confidence: 99%

“…A 30-minute NBO preparation was performed immediately before intravenous injection of MPIO-αVCAM-1. 7,8 This NBO preparation suppressed the hemorrhage-related signal voids and allowed tracking of MPIO-αVCAM-1-induced signal voids. In this model, ICH induced a strong vascular inflammation in the whole brain, which was particularly significant in the perihematoma area ( Figure 5).…”

mentioning

confidence: 99%

Intracerebral Hematomas Disappear on T2*-Weighted Images During Normobaric Oxygen Therapy

Gaberel

Gakuba²,

Hébert³

et al. 2013

Stroke

Self Cite

View full text Add to dashboard Cite

ICH was induced by intrastriatal collagenase injection in 16 mice. One mouse died during the surgery and was therefore excluded from the analysis. Three behavioral tests were performed before the ICH and at +24 hours to assess the functional deficits induced by the ICH Background and Purpose-The aim of the present study was to investigate the effects of normobaric oxygen (NBO) therapy on T2*-weighted images of intracranial hemorrhages (ICHs). Methods-Two common models of ICH were performed in mice, and longitudinal T2*-weighted images of the hematomas were acquired under normoxia or NBO. The effects of NBO were also investigated on perfusion-weighted imaging, susceptibility-weighted imaging, and molecular imaging of vascular cell adhesion molecule-1 after ICH. Last, we performed neurological testing, including neuroscore, actimetry, and gait analysis (Catwalk), to study the influence of NBO on neurological outcome of mice presenting ICH. Results-Our results demonstrated that NBO, even during a short period of time, dramatically reduces the sensitivity of T2*-weighted imaging to detect ICH. Moreover, we provide evidence that the disappearance of ICH on T2*-weighted imaging could be used to improve accuracy of perfusion-weighted imaging and to allow molecular imaging after ICH. Importantly, a 30-minute NBO preparation 24 hours after ICH onset does not influence neurological outcome. Conclusions-We provide an experimental demonstration that NBO significantly affects T2*-weighted imaging in ICH.Although this phenomenon could lead to inaccurate assessment of ICH volume, it could also be safely used to allow perfusion-weighted imaging and molecular imaging. in mice. The general state of the mice was assessed using a 5-point neuroscore scale (0=no apparent deficit; 1=slight deficit; 2=circling; 3=heavy circling or no movement at all; or 4=death). 4 The spontaneous global locomotor activity was quantified during 10 minutes using an actimeter (Imetronic, Pessac, France) as described previously.5 Briefly, global locomotor activity was quantified using activity cages equipped with horizontal infrared beams located across the long axis of the cage (IMETRONIC, France). Mice were placed in individual acrylic chambers (30×20×20 cm) for 10 minutes. The number of horizontal movements (horizontal crossings) was determined by breaks in movement-sensitive photobeams that were then converted into locomotor activity counts. A gait analysis was also performed using the Catwalk XT system (Noldus Information Technology, Wageningen, The Netherlands). The apparatus consists of an enclosed walkway (130×68×152 cm) on a glass plate that is traversed by the mice from one side to the other. Green light enters at the long edge of the plate and is completely internally reflected. Light is able to escape only at those areas where the animal's paws make contact with the glass plate; as a result, the light is scattered. Real footprints are captured by a high-speed video camera that is positioned underneath the walkway. The video camera transforms...

show abstract

Ultra-sensitive molecular MRI of cerebrovascular cell activation enables early detection of chronic central nervous system disorders

Cited by 65 publications

References 19 publications

Molecular magnetic resonance imaging discloses endothelial activation after transient ischaemic attack

Molecular magnetic resonance imaging discloses endothelial activation after transient ischaemic attack

Ultra-Sensitive Molecular MRI of Vascular Cell Adhesion Molecule-1 Reveals a Dynamic Inflammatory Penumbra After Strokes

Intracerebral Hematomas Disappear on T2*-Weighted Images During Normobaric Oxygen Therapy

Contact Info

Product

Resources

About