Transcriptional regulation of connective tissue growth factor by sphingosine 1‐phosphate in rat cultured mesangial cells

Katsuma, Susumu; Ruike, Yoshinao; Yano, Takeaki; Kimura, Mai; Hirasawa, Akira; Tsujimoto, Gozoh

doi:10.1016/j.febslet.2005.03.073

Cited by 36 publications

(28 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…CTGF expression is increased by high glucose (47,48), as well as being elevated in fatty liver disease (49,50), and atherosclerotic plaques (51). A possible link between fatty acid metabolism and CTGF expression is indicated by the observation that sphingosine 1-phosphate, signaling through sphingosine 1-phosphate receptors, directly increases CTGF mRNA in mesangial cells (52), smooth muscle (53), fibroblasts (54), and endothelial cells (55). Another possibility is that extracellular fatty acids are signaling directly through cell surface receptors, such as the toll-like receptors or others, which are present in skeletal muscle (56,57).…”

Section: Discussionmentioning

confidence: 99%

Paradoxical Changes in Muscle Gene Expression in Insulin-Resistant Subjects After Sustained Reduction in Plasma Free Fatty Acid Concentration

et al. 2007

View full text Add to dashboard Cite

Lipid oversupply plays a role in developing insulin resistance in skeletal muscle, decreasing expression of nuclearencoded mitochondrial genes, and increasing extracellular matrix remodeling. To determine if a decrease in plasma lipid content reverses these abnormalities, insulin-resistant subjects with a family history of type 2 diabetes had euglycemic clamps and muscle biopsies before and after acipimox treatment to suppress free fatty acids. Free fatty acids fell from 0.584 ؎ 0.041 to 0.252 ؎ 0.053 mmol/l (P < 0.001) and glucose disposal increased from 5.28 ؎ 0.46 to 6.31 ؎ 0.55 mg ⅐ kg ؊1 ⅐ min ؊1 (P < 0.05) after acipimox; intramuscular fatty acyl CoA decreased from 10.3 ؎ 1.9 to 4.54 ؎ 0.82 pmol/mg muscle (P < 0.01). Paradoxically, expression of PGC-1-and nuclear-encoded mitochondrial genes decreased after acipimox, and expression of collagens I and III ␣-subunits (82-and 21-fold increase, respectively, P < 0.05), connective tissue growth factor (2.5-fold increase, P < 0.001), and transforming growth factor-␤1 increased (2.95-fold increase, P < 0.05). Therefore, a reduction in lipid supply does not completely reverse the molecular changes associated with lipid oversupply in muscle. Changes in expression of nuclearencoded mitochondrial genes do not always correlate with changes in insulin sensitivity. Diabetes 56:743-752, 2007

show abstract

Section: Discussionmentioning

confidence: 99%

Paradoxical Changes in Muscle Gene Expression in Insulin-Resistant Subjects After Sustained Reduction in Plasma Free Fatty Acid Concentration

et al. 2007

View full text Add to dashboard Cite

show abstract

“…ChIP assay was performed as previously described [13] using a ChIP assay kit (Upstate Biotechnology) and P/CAF antibody (Santa Cruz). PCR primers for the amplified portion of the rat CTGF promoter were: rCTGFChIP: 5'tcggggcggaggttggtgtc3' and rCTGFChIP: 5'tttctaggggcccgtggtatctgc3'…”

Section: Chromatin Immunoprecipitation (Chip)mentioning

confidence: 99%

The Kruppel-like factor KLF15 inhibits connective tissue growth factor (CTGF) expression in cardiac fibroblasts

Wang

Haldar

Lü

et al. 2008

Journal of Molecular and Cellular Cardiology

View full text Add to dashboard Cite

Cardiac fibrosis is a hallmark feature of pathologic remodeling of the heart in response to hemodynamic or neurohormonal stress. Accumulating evidence implicates connective tissue growth factor (CTGF) as a key mediator of this process. Our group has previously identified Kruppel-Like Factor 15 (KLF15) as an important regulator of cardiac remodeling in response to stress; however, the role of this transcription factor in cardiac fibrosis has not been reported. Here we provide evidence that treatment of neonatal rat ventricular fibroblasts (NRVFs) with the potent pro-fibrotic agent Transforming Growth Factor-β1 (TGFβ1) strongly reduces KLF15 expression while inducing the pro-fibrotic factor CTGF. Adenoviral overexpression of KLF15 inhibits basal and TGFβ1-induced CTGF expression in NRVFs. Furthermore, hearts from KLF15 −/− mice subjected to aortic banding exhibited increased CTGF levels and fibrosis. From a mechanistic standpoint, KLF15 inhibits basal and TGFβ1-mediated induction of the CTGF promoter. Chromatin Immunoprecipitation (ChIP) and electrophoretic mobility shift assays demonstrate that KLF15 inhibits recruitment of the coactivator P/CAF to the CTGF promoter with no significant effect on Smad3-DNA binding. Consistent with this observation, KLF15 mediated repression of the CTGF promoter is rescued by P/CAF overexpression. Our result implicates KLF15 as a novel negative regulator of CTGF expression and cardiac fibrosis.

show abstract

“…ChIP assay was carried out using Chromatin Immunoprecipitation Assay Kit (Upstate Biotechnology, Inc., Lake Placid, NY, USA) as described previously (Katsuma et al 2005). In brief, 697 cells were treated with or without DEX for 1 h. After crosslinking by adding formaldehyde, cells were washed with PBS, resuspended in SDS lysis buffer, and sonicated to shear genomic DNA.…”

Section: Chromatin Immunoprecipitationmentioning

confidence: 99%

“…GZMAint1B, GZMAint1C, and GZMAint1D were prepared from pGL3-GZMAint1A by BalI (+562), Bpu1102I (+1141), and EcoRI (+2170) digestion, respectively. GZMADGRE, a mutant plasmid lacking GRE, was generated by PCR-mediated mutagenesis as described previously (Katsuma et al 2005). This fragment was inserted into the BamHI site of pGL3-GZMAup2k (downstream of luciferase gene) to generate pGL3-GZMAup2k-dE (Fig.…”

Section: Chromatin Immunoprecipitationmentioning

confidence: 99%

“…Luciferase reporter assay was carried out using DualGlo Luciferase Assay System (Promega Corporation, Madison, WI, USA) as described previously (Katsuma et al 2005). In brief, approximately 2 · 10 5 HepG2 cells were grown overnight in 60 mm dishes and transfected using Lipofectamine Reagent and Plus Reagent (Invitrogen Corp., Carlsbad, CA, USA) with 2 lg of reporter constructs, 0.5 lg of GR expression vector (pcDNA3 Flag-hGRa, a kind gift from Professor Shigeaki Kato, University of Tokyo), and 0.5 lg of pRL-TK vector (Promega Corporation, Madison, WI, USA) for an internal control.…”

Section: Luciferase Reporter Assaymentioning

confidence: 99%

See 1 more Smart Citation

Glucocorticoid-induced alternative promoter usage for a novel 5′ variant of granzyme A

et al. 2006

Self Cite

View full text Add to dashboard Cite

Glucocorticoids exert diverse physiological functions through transcriptional regulation of genes including granzyme A (GZMA). GZMA is one of the apoptotic effectors localized in cytotoxic T lymphocytes and is considered to mediate glucocorticoidinduced apoptosis of human leukemia 697 cells. In the present study, we identified a novel 5¢ variant transcript of GZMA in dexamethasone (DEX)-treated 697 cells. We designated this novel transcript as GZMAb. The transcription of GZMAb starts at 290 bp downstream of the first intronic glucocorticoid response element (GRE). Chromatin immunoprecipitation assay showed that glucocorticoid receptor (GR) binds to the intronic GRE in a DEX-dependent manner. Luciferase assay and RT-PCR also showed that DEX induces GZMAb transcription mediated by GR binding to the intronic GRE. Our results show that there exist at least two transcripts in human GZMA, whose expression is differentially regulated by glucocorticoid.

show abstract

Transcriptional regulation of connective tissue growth factor by sphingosine 1‐phosphate in rat cultured mesangial cells

Cited by 36 publications

References 34 publications

Paradoxical Changes in Muscle Gene Expression in Insulin-Resistant Subjects After Sustained Reduction in Plasma Free Fatty Acid Concentration

Paradoxical Changes in Muscle Gene Expression in Insulin-Resistant Subjects After Sustained Reduction in Plasma Free Fatty Acid Concentration

The Kruppel-like factor KLF15 inhibits connective tissue growth factor (CTGF) expression in cardiac fibroblasts

Glucocorticoid-induced alternative promoter usage for a novel 5′ variant of granzyme A

Contact Info

Product

Resources

About