Thermoregulation of protein synthesis in Borrelia burgdorferi

Cluss, R G; Boothby, John T.

doi:10.1128/iai.58.4.1038-1042.1990

Cited by 51 publications

(34 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…There are indications that protein profiles and antigenic characterization of surface proteins may be less reliable for the classification of B. burgdorferi (44,60) since antigenic changes may occur during in vitro cultivation. These changes may be due to loss of plasmids, gene rearrangements, or gene expression and regulatory processes (17,24,45). This was the main reason why we used only low-passage isolates.…”

Section: Discussionmentioning

confidence: 99%

Genotypic and phenotypic analysis of Borrelia burgdorferi isolates from The Netherlands

et al. 1995

View full text Add to dashboard Cite

Sixty-three Borrelia burgdorferi isolates recovered from Ixodes ricinus ticks collected in 17 locations in The Netherlands and three Dutch human skin isolates were characterized by rRNA gene restriction fragment length polymorphism, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and Western blotting (immunoblotting). All three human isolates belonged to B. burgdorferi group VS461. Of the tick isolates, 29 (46%) were B. burgdorferi sensu stricto, 2 (3%) were group VS461, 19 (30%) were Borrelia garinii, and 13 (21%) were different from any previously described genomic species. On the basis of the criteria described, 12 isolates formed a distinct genomic group, designated M19. rRNA gene restriction patterns of the group M19 isolates resembled but were not identical to the B. garinii patterns. Hybridization of digested DNA with a flagellin probe confirmed the separation of group M19 from the B. garinii isolates. One isolate, M63, was different from all the others. In conclusion, the occurrence of B. burgdorferi sensu stricto, B. garinii, and B. burgdorferi group VS461 in ticks from The Netherlands corresponds with the occurrence of these genomic species among tick isolates from other European countries. However, our findings suggest that B. burgdorferi sensu lato probably contains more than three genomic species.

show abstract

Section: Discussionmentioning

confidence: 99%

Genotypic and phenotypic analysis of Borrelia burgdorferi isolates from The Netherlands

et al. 1995

View full text Add to dashboard Cite

show abstract

“…Difficulties in inducing recombinant 60 kDa groEL analogues in other genera (i.e. Borrelia burgdorferi) have also been observed [29].…”

Section: Tggtttcggtgatcgtcgtaaag••atgttacaagacattgctatccttact••gggcgamentioning

confidence: 99%

Sequence analysis of the Legionella micdadei groELS operon

Hindersson

1991

FEMS Microbiology Letters

View full text Add to dashboard Cite

A 2.7 kb DNA fragment encoding the 60 kDa common antigen (CA) and a 13 kDa protein of Legionella micdadei was sequenced. Two open reading frames of 57,677 and 10,456 Da were identified, corresponding to the heat shock proteins GroEL and GroES, respectively. Typical -35, -10, and Shine-Dalgarno heat shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei, Western blot analysis with an L. micdadei specific anti-groEL antibody did not reveal a significant increase in the amount of the GroEL protein during heat shock in L. micdadei or in the recombinant E. coli expressing L. micdadei GroEL.

show abstract

“…1990). Heat-shock proteins have been found in all organisms tested, including B. burgdorferi (Carreino etai., 1990;Cluss and Boothby, 1990;Hansen etai., 1988;Shanafelt ef ai., 1991;Stamm ef ai.. 1991), and several have been highly conserved throughout evolution (Morimoto et ai., 1990). In Escherichia coii, higher levels of some heat-shock proteins are required for survival at high temperatures and mutants defective in induction of heatshock protein synthesis are unable to grow at temperatures above 20°C (Zhou efa/., 1988).…”

Section: Introductionmentioning

confidence: 99%

Isolation of dnaJ, dnaK, and grpE homologues from Borrelia burgdorferi and complementation of Escherichia coli mutants

Tilly

Hauser

Campbell

et al. 1993

Molecular Microbiology

View full text Add to dashboard Cite

The heat-shock proteins DnaJ, DnaK, and GrpE are involved in the replication of various species of DNA in Escherichia coli, in addition to their roles in other processes, including protein disaggregation and export. We have cloned the Borrelia burgdorferi homologues of these genes. DNA sequence analysis revealed an open reading frame encoding a protein that is 62% identical to the E. coli DnaK protein. Genes homologous to the E. coli grpE and dnaJ genes, encoding products 28% and 39% identical to their homologues, are located up- and downstream, respectively, of the B. burgdorferi dnaK gene. No obvious promoters were detected in the sequenced DNA, although a potential transcription terminator was found downstream of the dnaJ gene, so these three genes may form an operon, perhaps with a fourth gene located upstream of the grpE gene. The grpE homologue complemented an E. coli grpE mutant and the dnaJ homologue complemented an E. coli dnaJ mutant, whereas the B. burgdorferi dnaK gene did not complement dnaK mutants.

show abstract

Thermoregulation of protein synthesis in Borrelia burgdorferi

Cited by 51 publications

References 27 publications

Genotypic and phenotypic analysis of Borrelia burgdorferi isolates from The Netherlands

Genotypic and phenotypic analysis of Borrelia burgdorferi isolates from The Netherlands

Sequence analysis of the Legionella micdadei groELS operon

Isolation of dnaJ, dnaK, and grpE homologues from Borrelia burgdorferi and complementation of Escherichia coli mutants

Contact Info

Product

Resources

About