The Utility of Peanut Components in the Diagnosis of IgE-Mediated Peanut Allergy Among Distinct Populations

Lieberman, Jay; Glaumann, Susanne; Batelson, Sofia; Borres, Magnus P.; Sampson, Hugh A.; Nilsson, Caroline

doi:10.1016/j.jaip.2012.11.002

Cited by 91 publications

(105 citation statements)

References 26 publications

Supporting

Mentioning

101

Contrasting

Unclassified

Order By: Relevance

“…We found that purified Ara h 2 was sufficient to induce IgE production in mice, leading to anaphylaxis upon challenge, and could induce bystander sensitization, demonstrating inherent adjuvant activity. Ara h 2 is the dominant allergen in peanut, and component testing has indicated that IgE against Ara h 2 is predictive of clinical reactivity in patients (21). Interestingly, we did not observe innate effects of Ara h 2 on human keratinocytes (data not shown), and, unlike Ara h 1, Ara h 2 is not significantly glycosylated.…”

Section: Discussionmentioning

confidence: 55%

See 1 more Smart Citation

Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Tordesillas¹,

Goswami²,

Benedé³

et al. 2014

J. Clin. Invest.

Self Cite

193

208

View full text Add to dashboard Cite

Cells were seeded in 24-well plates and stimulated with CPE or soy extract. Cells were recovered at several time points for RNA isolation with the RNeasy Mini Kit (Qiagen).Bone marrow-derived DCs. Bone marrow cells were collected from femurs and cultured for 10 days in RPMI 1640 with l-glutamine (Gibco, Life Technologies), supplemented with 10% fetal bovine serum (Gemini Bio-products), penicillin/streptomycin (Gibco, Life Technologies), 50 μM 2-Mercaptoethanol (Sigma-Aldrich), and 20 ng/ml GM-CSF (Peprotech). At day 10, bone marrow-derived DCs were collected and resuspended in complete RPMI at a concentration of 5 × 10 5 cells per ml. Cells were stimulated for 3 hours with CPE (50 μg/ml), followed by RNA isolation with the RNeasy Mini Kit (Qiagen).Real-time PCR. RT-PCR was performed, starting from 1 μg total RNA, using SuperScript II Reverse Transcriptase (Invitrogen, Life Technologies). cDNA was amplified using the Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies) and run on an Applied Biosystems 7300 Real-Time Detection System, using the following primers: mouse Il6, F, TTCCATCCAGTTGCCTTCTTG; R, GGGAGTGGTATCCTCTGTGAAGTC; mouse Il1b (65), F, TTGACGGACCCCAAAAGAT; R, GAGCGCTCACGAACAGTTG; mouse Il10 (25), F, TGCTATGCTGCCTGCTCTTA; R, TCATTTC-CGATAAGGCTTGG; mouse Ox40l (25), F, CCCTCCAATCCAAA-GACTCA; R, ATCCTTCGACCATCGTTCAG; mouse Il33, F, ATC-GGGTACCAAGCATGAAG; R, GACTTGCAGGACAGGGAGAC; mouse Tslp (48), F, GAGAGAAATGACGGTACTCA; R, CTACAGT-TAGGTTTGCCCTA; mouse Il25, F, TGTTGCATTCTTGGCAAT-GATC; R, GACTGCAGCCCTCCTGGAT; human IL6, F, AAA-GAGGCACTGGCAGAAAA; R, CAGGGGTGGTTATTGCATCT; human IL33, F, GAGCTAAGGCCACTGAGGAA; R, TGGGCCTTT-GAAGTTCCATA.GADPH and β-actin were used as the housekeeping genes. Relative quantification was performed using the comparative threshold cycle method (2 -ΔΔCt ). The changes in gene expression were calculated with respect to the untreated cells. All amplifications were carried out in duplicates. Antigen presentation assay. Antigen presentation assay was performed as previously described (19). BALB/c mice were exposed to 10 mg OVA in the presence or absence of 1 mg CPE. After 24 hours, DCs were purified from inguinal lymph nodes by using CD11c microbeads (Miltenyi Biotec). DCs were cultured at a ratio of 1:5 with DO11.10 CD4 + T cells. After 72 hours, cells were restimulated with anti-CD3/CD28, supernatants were harvested, and cytokines were measured by ELISA according to manufacturer's instructions (all from eBioscience).In neutralization experiments, anti-ST2 was injected prior to exposure with OVA and CPE, as described above. For the OX40L neu- The Journal of Clinical InvestigationR e s e a R c h a R t i c l e 4 9 7 4

show abstract

Section: Discussionmentioning

confidence: 55%

“…Despite the induction of antibody responses to Ara h 1 and Ara h 2, only mice exposed to Ara h 2 experienced significant anaphylactic reactions following intraperitoneal challenge (Supplemental Figure 5B). Ara h 2 is the component of peanut linked most closely to clinical reactivity in humans (21).…”

Section: Resultsmentioning

confidence: 99%

Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Tordesillas¹,

Goswami²,

Benedé³

et al. 2014

J. Clin. Invest.

Self Cite

193

208

View full text Add to dashboard Cite

show abstract

“…2,31,238 Studies of the clinical utility of CRD for specific allergens have shown promising results for a relatively small number of foods. Recent studies propose sIgE antibodies to Ara h 2 as the most common peanut allergen associated with clinical reactivity, [239][240][241] and sensitization to Ara h 1, 2, or 3 has been associated with increased severity of reactions in certain subjects, especially compared with those sensitized to Ara h 8 (Bet v 1 related), who experience predominantly oral allergy symptoms. 242 Similarly, sensitization to Cor a 9 and Cor a 14 has been associated with both symptom severity and objective findings during DBPCFCs to hazel nut.…”

Section: Section V: Adverse Reactions To Food Additivesmentioning

confidence: 99%

Food allergy: A practice parameter update—2014

Bernstein¹,

Blessing-Moore²,

Khan³

et al. 2014

Journal of Allergy and Clinical Immunology

Self Cite

708

564

View full text Add to dashboard Cite

“…In this study, an Ara h 2 sIgE level of 0.55 kU/L was found to be 93 % sensitive and 100 % specific for PN allergy. Several additional studies, mostly in children, have found Ara h 2 to be the PN component most strongly associated with clinical reactivity, with higher levels of Ara h 2 sIgE correlating to a greater likelihood of clinical allergy [32][33][34][35][36].…”

Section: Peanut Allergymentioning

confidence: 99%

“…Among the known components, Ara h 2 has been shown in multiple studies to be the most important predictor of clinical reactivity, though Ara h 1, 3, and 6 have also been associated with severe reactions [32][33][34][35][36][37]. Ara h 9 has been correlated with mild to severe symptoms in Mediterranean patients [30•, 38].…”

Section: Peanut Allergymentioning

confidence: 99%

Allergen Component Testing in the Diagnosis of Food Allergy

Schussler

Kattan

2015

Curr Allergy Asthma Rep

View full text Add to dashboard Cite

IgE-mediated food allergies are an important public health problem, affecting 5 % of adults and 8 % of children, with numerous studies indicating that the prevalence is increasing. Food allergic reactions can range in severity from mild to severe and life threatening. Accurate diagnosis of food allergy is necessary not only to provide appropriate and potentially life-saving preventive measures but also to prevent unwarranted dietary restrictions. The diagnosis of food allergy has traditionally been based on clinical history and food specific IgE (sIgE) testing, including skin prick testing (SPT), serum tests, or both. These tests tend to be extremely sensitive, but positive test results to foods that are tolerated are common. Studies of allergen component-resolved diagnostics (CRD) show that adjuvant use of this modality may provide a more accurate assessment in the diagnosis of food allergy, though the reported benefits are questionable for a number of major allergens. Furthermore, diagnostic cutoff values have been difficult to determine for allergens where component testing has been demonstrated to be beneficial.

show abstract

The Utility of Peanut Components in the Diagnosis of IgE-Mediated Peanut Allergy Among Distinct Populations

Cited by 91 publications

References 26 publications

Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Food allergy: A practice parameter update—2014

Allergen Component Testing in the Diagnosis of Food Allergy

Contact Info

Product

Resources

About