The G-protein-coupled receptor kinase 5 inhibits NFκB transcriptional activity by inducing nuclear accumulation of IκBα

Abstract

G-protein-coupled receptor (GPCR) kinases, GRKs, are known as serine/threonine kinases that regulate GPCR signaling, but recent findings propose functions for these kinases besides receptor desensitization. Indeed, GRK5 can translocate to the nucleus by means of a nuclear localization sequence, suggesting that this kinase regulates transcription events in the nucleus. To evaluate the effect of GRK5-IB␣ interaction on NFB signaling, we induced the overexpression and the knockdown of GRK5 in cell cultures. GRK5 overexpression causes nuclear accumulation of IB␣, leading to the inhibition of NFB transcriptional activity. Opposite results are achieved by GRK5 knockdown through siRNA. A physical interaction between GRK5 and IB␣, rather than phosphorylative events, appears as the underlying mechanism. We identify the regulator of gene protein signaling homology domain of GRK5 (RH) and the N-terminal domain of IB␣ as the regions involved in such interaction. To confirm the biological relevance of this mechanism of regulation for NFB, we evaluated the effects of GRK5-RH on NFB-dependent phenotypes. In particular, GRK5-RH overexpression impairs apoptosis protection and cytokine production in vitro and inflammation and tissue regeneration in vivo. Our results reveal an unexpected role for GRK5 in the regulation of NFB transcription activity. Placing these findings in perspective, this mechanism may represent a therapeutic target for all those conditions involving excessive NFB activity.angiogenesis ͉ gene transcription ͉ inflammation ͉ signal transduction G -protein-coupled receptor (GPCR) kinases, GRKs, constitute a large family of serine/threonine protein kinases that regulate GPCR signaling (1-3), consisting of 7 isoforms that share structural and functional similarities (4). A central catalytic domain is flanked by an N-terminal domain that includes a region of homology to regulators of G-protein signaling (RH) and a C-terminal domain of variable length (5, 6). The catalytic domain of GRKs is relatively well-conserved among the members of different subfamilies (Ϸ45% sequence identity), whereas N-terminal RH domains display weak homology (Ϸ27%) and C termini have little or no sequence homology. GRKs have different tissue distribution, subcellular localization, and kinase activity regulation (7,8). GRKs mostly localize at the plasma membrane (2), but recently Johnson et al. (7) demonstrated that GRK4-6 (but not other GRKs) can shuttle between cytosol and nucleus through functional nuclear localization sequence (NLS) and nuclear exporting sequence (NES), thus suggesting a nuclear effect for the GRK4-6 subfamily.NFB is an ubiquitously expressed and highly regulated dimeric transcription factor (3) regulating the expression of genes responsible for innate and adaptive immunity, tissue regeneration, stress responses, apoptosis, cell proliferation, and differentiation (9-14). Within the canonical view of the regulation of the NFB activity, the inactive NFB/IB␣ complex localizes in the cytosol until an extracellular stimulus, ...

Nuclear-delimited Angiotensin Receptor-mediated Signaling Regulates Cardiomyocyte Gene Expression

“…In recent years, we and others have confirmed that endothelin (15), ␤-and ␣-adrenergic (17, 23), prostaglandin E 2 (24) receptors, in addition to the signaling molecules associated with many GPCRs, including adenylate cyclase (25), G-protein coupled receptor kinases (GRK) (26,27), phospholipase proteins (22), G i , G s , and G q , are present on the nuclear/perinuclear membranes in a constitutive manner, independent of agonist stimulation. Determining the subcellular localization of proteins provides crucial information concerning their function and interaction with other molecules in a specific microenvironment, and thus represents a critical step in genome annotation.…”

Intracardiac Injection of AdGRK5-NT Reduces Left Ventricular Hypertrophy by Inhibiting NF-κB–Dependent Hypertrophic Gene Expression

“…11 The antibodies anti-IB␣, actin, and histone 3 were from Santa Cruz Biotechnology, Inc; anticleaved caspase 3, NF-B, p-NFB (p65), and phospho-cAMP responsive element binding (p-CREB) antibodies were from Cell Signaling Technology. Densitometric analysis was performed using Image Quant software (Molecular Dynamics, Inc).…”

“…In H9C2 cardiomyoblasts, AdGRK5-NT caused an increase of total IB␣ levels ( Figure 1A), analyzed by Western blot, as described previously in other cellular types. 11,12 The effect of GRK5-NT on NF-B activity was evaluated by luciferase assay. PE increased NF-B transcription activity, and the overexpression of GRK5-NT reduced such effect both in basal conditions and after PE stimulation ( Figure 1B), suggesting that NF-B is induced by hypertrophic stimuli in cardiac cells and that GRK5-NT is able to inhibit such phenomenon.…”

“…11 For the competition, assay nuclear extracts were incubated with a 50-fold excess of unlabeled oligos for 20 minutes before adding the labeled oligo. Electrophoretic mobilityshift assay for organic cation transporter 1 (OCT-1) binding was performed as a loading control (5Јtgtcgaatgcaaatcctctcctt3Ј).…”

“…The family of G protein-coupled receptor kinases (GRKs) and, in particular GRK2 and GRK5, possesses the ability to bind both NF-B and its inhibitor, IB␣. 10,11 In particular, GRK5, by means of its RGS homology (RH) domain within the amino terminus, interacts with IB␣ leading to the stabilization and accumulation of the IB␣/NF-B complex in the nucleus and, consequently, to the inhibition of NF-B transcriptional activity. 11 This feature of the RH domain of GRK5 leads to the hypothesis that the use of peptides that are designed and engineered on this sequence of the kinase may induce NF-B inhibition.…”