The Contribution of Accessory Toxins of <i>Vibrio cholerae</i> O1 El Tor to the Proinflammatory Response in a Murine Pulmonary Cholera Model

Fullner, Karla Jean; Boucher, J C; Hanes, Martha A.; Haines, G. Kenneth; Meehan, Brian; Walchle, Cynthia; Sansonetti, Philippe J.; Mekalanos, John J.

doi:10.1084/jem.20020318

Cited by 107 publications

(139 citation statements)

References 41 publications

(45 reference statements)

Supporting

Mentioning

131

Contrasting

Order By: Relevance

“…RTX activity in V. cholerae appears to affect regulators of host-cell actin polymerization, causing dramatic changes in cytoskeletal structure, leading to the loss of tight-junction integrity (31,33). The expression or potential activity of a V. fischeri RTX protein has not yet been investigated, but it is intriguing that symbiotic infection of the squid host results in a set of controlled changes in actin deployment in epithelial cells surrounding the bacteria in the light organ (34,35).…”

Section: Resultsmentioning

confidence: 99%

Complete genome sequence of Vibrio fischeri : A symbiotic bacterium with pathogenic congeners

Ruby

Urbanowski

Campbell

et al. 2005

Proc. Natl. Acad. Sci. U.S.A.

332

238

View full text Add to dashboard Cite

Vibrio fischeri belongs to the Vibrionaceae, a large family of marine ␥-proteobacteria that includes several dozen species known to engage in a diversity of beneficial or pathogenic interactions with animal tissue. Among the small number of pathogenic Vibrio species that cause human diseases are Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio vulnificus, the only members of the Vibrionaceae that have had their genome sequences reported. Nonpathogenic members of the genus Vibrio, including a number of beneficial symbionts, make up the majority of the Vibrionaceae, but none of these species has been similarly examined. Here we report the genome sequence of V. fischeri ES114, which enters into a mutualistic symbiosis in the light organ of the bobtail squid, Euprymna scolopes. Analysis of this sequence has revealed surprising parallels with V. cholerae and other pathogens.genomics ͉ pili ͉ symbiosis ͉ toxins ͉ toxin-coregulated pilus

show abstract

Section: Resultsmentioning

confidence: 99%

Complete genome sequence of Vibrio fischeri : A symbiotic bacterium with pathogenic congeners

Ruby

Urbanowski

Campbell

et al. 2005

Proc. Natl. Acad. Sci. U.S.A.

332

238

View full text Add to dashboard Cite

show abstract

“…Strain VOV8 was generated for this study by using plasmids and methods described previously (24). For plasmid-based production of CT, the ctxAB operon was amplified from strain P27459 chromosomal DNA with oligonucleotides JQctxAB-F/NcoI (CCATGGTAAAGATAATATTTGTG TTTTTTATTTTCC) and JQctxAB-R/EcoRV (GATATCTTAATTTGCC ATACTAATTGCGG) (the NcoI and EcoRI restriction sites are underlined).…”

Section: Methodsmentioning

confidence: 99%

Mechanisms of Inflammasome Activation by Vibrio cholerae Secreted Toxins Vary with Strain Biotype

et al. 2015

View full text Add to dashboard Cite

Activation of inflammasomes is an important aspect of innate immune responses to bacterial infection. Recent studies have linked Vibrio cholerae secreted toxins to inflammasome activation by using murine macrophages. To increase relevance to human infection, studies of inflammasome-dependent cytokine secretion were conducted with the human THP-1 monocytic cell line and corroborated in primary human peripheral blood mononuclear cells (PBMCs). Both El Tor and classical strains of V. cholerae activated ASC (apoptosis-associated speck-like protein-containing a CARD domain)-dependent release of interleukin-1␤ (IL-1␤) when cultured with human THP-1 cells, but the pattern of induction was distinct, depending on the repertoire of toxins the strains produced. El Tor biotype strains induced release of IL-1␤ dependent on NOD-like receptor family pyrin domain-containing 3 (NLRP3) and ASC due to the secreted pore-forming toxin hemolysin. Unlike in studies with mouse macrophages, the MARTX toxin did not contribute to IL-1␤ release from human monocytic cells. Classical biotype strains, which do not produce either hemolysin or the MARTX toxin, activated low-level IL-1␤ release that was induced by cholera toxin (CT) and dependent on ASC but independent of NLRP3 and pyroptosis. El Tor strains likewise showed increased IL-1␤ production dependent on CT when the hemolysin gene was deleted. In contrast to studies with murine macrophages, this phenotype was dependent on a catalytically active CT A subunit capable of inducing production of cyclic AMP and not on the B subunit. These studies demonstrate that the induction of the inflammasome in human THP-1 monocytes and in PBMCs by V. cholerae varies with the biotype and is mediated by both NLRP3-dependent and -independent pathways. V ibrio cholerae is the causative agent of the diarrheal disease cholera. The O1 serogroup, which is most associated with disease, is divided into two biotypes, classical and El Tor. Classical strains were responsible for the six cholera pandemics that occurred during the 19th century and the first half of the 20th century and are noted for their severe clinical presentation. In 1961, the El Tor strains emerged as the cause of the ongoing seventh pandemic, completely displacing the classical strains from the environment and as a cause of cholera in humans (1). These strains colonize the intestine more effectively and spread between hosts more efficiently but cause fewer deaths and significantly more asymptomatic colonization (2).The primary virulence factor for pandemic cholera strains is cholera toxin (CT), an ADP-ribosylating toxin that disables the G␣ s subunit, resulting in increased cyclic AMP (cAMP) production and secretion of fluid from enterocytes due to the opening of chloride channels. The toxin is composed of the catalytically active A (CTA) subunit associated with five CTB subunits that bind to surface GM 1 gangliosides, facilitating toxin endocytosis (3). In addition to enterotoxigenic activity, CT has also been demonstrated to have immunomodulat...

show abstract

“…Similarly, large genes were identified in both symbionts with homology to those that encode RTX-like toxins, which aid in membrane disruption and host cell invasion by pathogenic and symbiotic bacteria (Fullner et al, 2002;Jeong et al, 2005;Ruby et al, 2005). Both T. teridinibacter and Photorhabdus luminescens, the symbiont of entomopathogenic nematodes, possess many similar secretion systems, adhesins and toxins, suggesting a role in mediating both adverse and beneficial interactions with eukaryotes (Ffrench-Constant et al, 2000;Duchaud et al, 2003;Yang et al, 2009).…”

Section: Genomic Implications For Intracellular Lifementioning

confidence: 99%

Genomic versatility and functional variation between two dominant heterotrophic symbionts of deep-sea Osedax worms

Goffredi

Zhang

et al. 2013

The ISME Journal

View full text Add to dashboard Cite

An unusual symbiosis, first observed at B3000 m depth in the Monterey Submarine Canyon, involves gutless marine polychaetes of the genus Osedax and intracellular endosymbionts belonging to the order Oceanospirillales. Ecologically, these worms and their microbial symbionts have a substantial role in the cycling of carbon from deep-sea whale fall carcasses. Microheterogeneity exists among the Osedax symbionts examined so far, and in the present study the genomes of the two dominant symbionts, Rs1 and Rs2, were sequenced. The genomes revealed heterotrophic versatility in carbon, phosphate and iron uptake, strategies for intracellular survival, evidence for an independent existence, and numerous potential virulence capabilities. The presence of specific permeases and peptidases (of glycine, proline and hydroxyproline), and numerous peptide transporters, suggests the use of degraded proteins, likely originating from collagenous bone matter, by the Osedax symbionts. 13 C tracer experiments confirmed the assimilation of glycine/ proline, as well as monosaccharides, by Osedax. The Rs1 and Rs2 symbionts are genomically distinct in carbon and sulfur metabolism, respiration, and cell wall composition, among others. Differences between Rs1 and Rs2 and phylogenetic analysis of chemotaxis-related genes within individuals of symbiont Rs1 revealed the influence of the relative age of the whale fall environment and support possible local niche adaptation of 'free-living' lifestages. Future genomic examinations of other horizontally-propogated intracellular symbionts will likely enhance our understanding of the contribution of intraspecific symbiont diversity to the ecological diversification of the intact association, as well as the maintenance of host diversity.

show abstract

The Contribution of Accessory Toxins of Vibrio cholerae O1 El Tor to the Proinflammatory Response in a Murine Pulmonary Cholera Model

Cited by 107 publications

References 41 publications

Complete genome sequence of Vibrio fischeri : A symbiotic bacterium with pathogenic congeners

Complete genome sequence of Vibrio fischeri : A symbiotic bacterium with pathogenic congeners

Mechanisms of Inflammasome Activation by Vibrio cholerae Secreted Toxins Vary with Strain Biotype

Genomic versatility and functional variation between two dominant heterotrophic symbionts of deep-sea Osedax worms

Contact Info

Product

Resources

About