Synthesis, antimicrobial activity and conformational analysis of the class IIa bacteriocin pediocin PA-1 and analogs thereof

Bédard, François; Hammami, Riadh; Zirah, Séverine; Rebuffat, Sylvie; Fliss, Ismaı̈l; Biron, Éric

doi:10.1038/s41598-018-27225-3

Cited by 76 publications

(57 citation statements)

References 72 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…(C) Peptide-membrane interaction. Peptide 6 (light blue)with membrane bonding residues and potential receptor binding residues colored in cyan and red respectively.CONCLUSIONAs previously observed with pediocin PA-1 analogs,43 the use of linear bactofencin A in biological medium yielded the same activity as the native cyclic counterpart. Modifications such as C-terminal amidation and replacement of the methionine residues with leucine allowed a fourfold increase in inhibitory activity against S. aureus.…”

supporting

confidence: 75%

“…bacteriocins can be very challenging since the presence of several features essential for their bioactivity, such as lasso structure, large macrocycles, lanthionines, glycosylated side chains or complicated peptide motifs can make the task very daunting. 42 showing the same activity, 43 no disulfide bond formation was performed and the linear analogs 7-18 used as is in the antimicrobial assays. Figure S5).…”

Section: Synthesis Of Bactofencin a And Analogs Thereof The Chemicalmentioning

confidence: 99%

See 1 more Smart Citation

Structure–Activity Relationships of the Bacteriocin Bactofencin A and Its Interaction with the Bacterial Membrane

2018

Self Cite

View full text Add to dashboard Cite

The antimicrobial peptide bactofencin A is an unmodified non-pediocin-like bacteriocin that inhibits several clinically relevant pathogens, including Listeria monocytogenes and Staphylococcus aureus. Here we report the synthesis and structure−activity relationship studies of bactofencin A and novel analogues thereof. Synthetic bactofencin A was a potent inhibitor of L. monocytogenes (MIC = 8.0 μM) and S. aureus (MIC = 4.0 μM), similar to the bacteriocin produced naturally by Lactobacillus salivarius. Of particular interest is the fact that linear analogues lacking the disulfide bond found in bactofencin A were as potent and also active against several strains of methicillin-resistant S. aureus (MRSA) and one strain of vancomycin-resistant S. aureus (VRSA). Supported by the structure−activity relationship study, investigation of the interaction of bactofencin A with bacterial membrane by molecular dynamics simulations showed the importance of the positively charged N-terminal tail for peptide−membrane interaction. These results suggest that the C-terminal macrocycle is involved in target protein binding and bacterial growth inhibition.

show abstract

supporting

confidence: 75%

Section: Synthesis Of Bactofencin a And Analogs Thereof The Chemicalmentioning

confidence: 99%

Structure–Activity Relationships of the Bacteriocin Bactofencin A and Its Interaction with the Bacterial Membrane

2018

Self Cite

View full text Add to dashboard Cite

show abstract

“…As expected, pediocin displayed activity only against L. coryniformis with EC 50 of 3 nM. This is in approximate agreement with published potency pf pediocin PA-1 and related bacteriocins (25–27).…”

Section: Resultssupporting

confidence: 90%

Charged Gram-positive species sequester and decrease the potency of pediocin PA-1 in mixed microbial settings

Trivedi

Nair

2020

Preprint

View full text Add to dashboard Cite

15Antimicrobial peptides (AMPs) have gained attention recently due to increasing antibiotic 16 resistance amongst pathogens. Most AMPs are cationic in nature and their preliminary 17 interactions with the negatively charged cell surface is mediated by electrostatic attraction. This 18 is followed by pore formation, which is either receptor-dependent or -independent and leads to 19 cell death. Typically, AMPs are characterized by their killing activity using bioactivity assays 20 to determine host range and degree of killing. However, cell surface binding is independent 21 from killing. Most of the studies performed to-date have attempted to quantify the peptide 22 binding using artificial membranes. Here, we use the narrow-spectrum class IIa bacteriocin 23 AMP pediocin PA-1 conjugated to a fluorescent dye as a probe to monitor cell surface binding. 24We developed a flow cytometry-based assay to quantify the strength of binding in target and 25 non-target species. Through our binding assays, we found a strong positive correlation between 26 cell surface charge and pediocin PA-1 binding. Interestingly, we also found inverse correlation 27 between zeta potential and pediocin PA-1 binding, the correlation coefficient for which 28 improved when only Gram-positives were considered. We also show the effect of the presence 29 of protein, salt, polycationic species, and other non-target species on the binding of pediocin 30PA-1 to the target organism. We conclude that the of presence of highly charged non-target 31 species, as well as solutes, can decrease the binding, and the apparent potency, of pediocin PA-32 1. Thus, these outcomes are highly significant to the use of pediocin PA-1 and related AMPs 33 in mixed microbial settings such as those found in the gut microbiota. 34 35

show abstract

“…Our data, support and co-operate with the result of Patil, has contributed new scientific information to the pediocin antimicrobial spectrum data bank. Besides, recombinant pediocin did not display activity against Staphylococcus aureus and Bacillus subtilis as was shown in Bactibase; however, this result is similar with the studies of Henderson (1992) and Bédard (2018), which reported that pediocin did not show activity against Staphylococcus aureus [3,32].…”

Section: Discussionsupporting

confidence: 86%

Heterologous Expression of Pediocin PA-1 inEscherichia coli

Thu

Thuy

Nghia

et al. 2019

Preprint

View full text Add to dashboard Cite

11Pediocin PA-1 is an antimicrobial peptide which has a strongly activity against some Gram -12 positive pathogens such as Listeria monocytogenes, Staphylococcus aureus, Enterococcus 13 faecalis…With the broad inhibitory spectrum as well as pH and temperature stability, pediocin has a 14 potential application in food preservation as well as pharmaceutical industry. For higher manufactory 15 efficiency, pediocin has been expressed in both prokaryote and eukaryote heterologous expression 16 system, mostly on Escherichia coli with different strategies. Here, we show a new strategy to produce 17 pediocin from Escherichia coli BL21(DE3) system as fusion form by using a vector containing NusA 18 tag. Our results showed that NusA fused pediocin almost presented in soluble form with high efficiency 19 (79.8 mg/l obtained by Ni-NTA purification). After remove the fusion tag, recombinant pediocin 20 showed antimicrobial activity against Listeria monocytogenes ATCC 13932 as 23.5x10 3 Au/mg as well 21 as against Enterococcus faecalis, Lactobacillus plantarum, and Streptococcus thermophilus, especially 22 Vibrio parahaemolyticus -a Gram-negative bacteria which have not been reported in antimicrobial 23 spectrum of pediocin on Bactibase. Recombinant pediocin is recorded to be stable to a wide range of 24 pH (1-12 for 1 hour) and temperature (100 o C for 15 min) as well as sensitive to protease treatment as Primer Sequence PedF CGCGGATCCGATGACGACGACAAGAAATATTATGGTAATGGTGTTA CCTGTGGTAAACATAGC PedR CCGCTCGAGCGGTTAACATTTATGATTACCCTGATGACCACC 60 DNA amplification product, after being treated by BamHI and XhoI restriction enzyme, 61 were then inserted into pET43.1a vector by T4 DNA ligase. The construction of pET43.1a 62 recombinant vector bearing ped gene denoted as pET43.1a -ped, was transformed into E. coli 126 by treating the purified pediocin respectively at 30, 50, 60, 70, 80, 90, 100 o C, 121 o C for 15 127 min. 128 The antimicrobial activity of pediocin was determined by agar diffusion test against the 129 indicator strain Listeria monocytogenes ATCC 13932. 130 Result 131 Construction of expression vector 132 Since pediocin is naturally produced in Pediococcus acidilactici, for expressing 133 recombinant pediocin in E. coli system, the DNA coding sequence of pediocin was analyzed 134 by Genscript Rare Codon Analysis tool in order to find out and optimize non-adaptable codons.

show abstract

Synthesis, antimicrobial activity and conformational analysis of the class IIa bacteriocin pediocin PA-1 and analogs thereof

Cited by 76 publications

References 72 publications

Structure–Activity Relationships of the Bacteriocin Bactofencin A and Its Interaction with the Bacterial Membrane

Structure–Activity Relationships of the Bacteriocin Bactofencin A and Its Interaction with the Bacterial Membrane

Charged Gram-positive species sequester and decrease the potency of pediocin PA-1 in mixed microbial settings

Heterologous Expression of Pediocin PA-1 inEscherichia coli

Contact Info

Product

Resources

About