Structural and functional insights into an archaealL-asparaginase obtained through the linker-less assembly of constituent domains

Abstract

Covalent linkers bridging the domains of multidomain proteins are considered to be crucial for assembly and function. In this report, an exception in which the linker of a two-domain dimeric L-asparaginase from Pyrococcus furiosus (PfA) was found to be dispensable is presented. Domains of this enzyme assembled without the linker into a conjoined tetrameric form that exhibited higher activity than the parent enzyme. The global shape and quaternary structure of the conjoined PfA were also similar to the wild-type PfA, as observed by their solution scattering profiles and X-ray crystallographic data. Comparison of the crystal structures of substrate-bound and unbound enzymes revealed an altogether new active-site composition and mechanism of action. Thus, conjoined PfA is presented as a unique enzyme obtained through noncovalent, linker-less assembly of constituent domains that is stable enough to function efficiently at elevated temperatures.

Simultaneous cell disruption and semi-quantitative activity assays for high-throughput screening of thermostable L-asparaginases

“…During substrate binding and product release with L- asparaginase, the opening and closing of the loop lid around activity site are absolute prerequisite 38 , 39 . An incompact structure around activity site may lead to free domains are to reorient spatially in a conformation state making it more accessible to the substrate, thereby increasing the specific activity 40 . S17G, R156S and K272A were located on the loops around the activity site.…”

Structure and function of the thermostableL-asparaginase fromThermococcus kodakarensis

“…However, this feature was finally interpreted and successfully refined as a phosphate ion. This was one of the components of the crystallization buffer and has been reported in other asparaginase structures (Tomar et al, 2014;Wehner et al, 1992). The phosphate anion occupies the binding site for the substrate and forms many interactions with the side chains of the neighbouring residues, including Thr11 and Thr85.…”

“…The phosphate anion occupies the binding site for the substrate and forms many interactions with the side chains of the neighbouring residues, including Thr11 and Thr85. Tomar et al (2014) also suggested that the binding of a ligand (asparagine, citrate or phosphate) stabilizes the flexible -hairpin, which acts as a gatekeeper and prevents further substrate entry. However, Yun et al (2007) reported that this hairpin is still not visible in the Asp-or Asn-bound structures.…”

Domains of Pyrococcus furiosus l-asparaginase fold sequentially and assemble through strong intersubunit associative forces

“…PCR-based site-directed mutagenesis was carried out using primer 5′CTTATCCAGCCAGAAG ATTTTGTAGATCTTGCTGAAAC3′ and its complement, and primer 5′ACAGTAACAAAGCTCATGTTTATTCTAG GCCACACAA3′ and its complementary pair for obtaining W60F (N-terminal Trp mutant) and W301F (C-terminal Trp mutant), respectively. All the proteins were purified by standard Ni-NTA-affinity procedure explained elsewhere (Bansal et al 2012;Tomar et al 2013Tomar et al , 2014. Transformed E. coli cells (Rosetta DE3), grown by shaking at 37 °C in LB medium (HiMedia) containing 50 µg ml −1 kanamycin and 17 µg ml −1 chloramphenicol (Sigma), were induced with 1 mM IPTG (Sigma) (at A 600 of 0.6) and harvested 14 h post-induction by centrifugation, followed by sonication.…”