Splinkerettes—improved vectorettes for greater efficiency in PCR walking

Devon, Rebecca S.; Porteous, David J.; Brookes, Anthony J.

doi:10.1093/nar/23.9.1644

Cited by 187 publications

(156 citation statements)

References 160 publications

Supporting

Mentioning

156

Contrasting

Order By: Relevance

“…special blunt-ended DNA adapters (Devon et al 1994), and used for ligation-mediated polymerase chain reaction (LMPCR). The primer sets used in each round hybridize speci¢cally to the inserted V H B1-8 gene and the long strand of the splinkerette, respectively.…”

Section: Resultsmentioning

confidence: 99%

“…For the detection of DSB, two oligonucleotides, 5'-CGAAGA GTAACCGTTGCTAGGAGAGACCGTGGCTGAATGGTG-TCGACACTAGTGG-3' and 5'-CCACTAGTGTCGACACCAG-TCCTAATTTTTTTTTTCAAAAAAA-3', were synthesized and duplexed to generate blunt ended, double-stranded splinkerettes (Devon et al 1994). DNA from 2 Â10 4 cell equivalents were ligated to splinkerettes (0.1pmol ml 71 ) in a 40 ml volume with 2 U of T4-DNA ligase (Boehringer, Mannheim, Germany).…”

Section: (D) Generation and Ligation Of Adaptersmentioning

confidence: 99%

“…In the ¢rst round the external splinkerette primer (CGAAGAG-TAACCGTTGCTAGGAGAGACC) (Devon et al 1994), which speci¢cally hybridizes to the long splinkerette-strand, was used in combination with either the external 5' V H B1-8 leader exon 1 primer (ampli¢cation of 5' break end in pÁ and pII samples) or one of the 3' external V H B1-8 gene primers (ampli¢cation of 3' break end): the 3' JC intron 1 primer for pÁ samples and 3' JC intron 2 primer for pII samples (Fukita et al 1998). For the second round of ampli¢cation the internal splinkerette primer (GTGGCTGAATGAGACTGGTGTCGAC), which speci¢cally hybridizes to the long splinkerette strand, was used either in combination with the nested 5' V H B1-8 leader exon 2 primer (ampli¢cation of 5' break end in pÁ and pII samples) or the nested 3' JC intron 3' primer and the 3' JC intron 1 primer for 3' break ends from pII and pÁ samples, respectively.…”

Section: (D) Generation and Ligation Of Adaptersmentioning

confidence: 99%

See 2 more Smart Citations

Indirect and direct evidence for DNA double–strand breaks in hypermutating immunoglobulin genes

Jacobs¹,

Rajewsky

Fukita

et al. 2001

Phil. Trans. R. Soc. Lond. B

View full text Add to dashboard Cite

The generation of a diverse antigen receptor repertoire is fundamental for the functionality of the adaptive immune system. While the V(D)J recombination process that generates the primary antigen receptor repertoire is understood in great detail, it is still unclear by which mechanism immunoglobulin (Ig) genes are further diversi¢ed by somatic hypermutation. Using mouse strains that carry a non-functional, prede¢ned V H D H J H gene segment in their IgH locus we demonstrate DNA double-strand breaks (DSBs) in and around V H D H J H in B cells undergoing somatic hypermutation. The generation of these DSBs depends on transcriptional activity, and their distribution along the V H D H J H segment parallels that of point mutations in the hypermutation domain. Furthermore, similar to hot spots of somatic hypermutation, 50^60% of all DSBs occur preferentially at RGYW motifs. DSBs may transiently dissociate the Ig promoter from the intronic enhancer to block further transcription and to initiate an error-prone nonhomologous DSB repair pathway. In accord with this model large deletions are frequently produced, along with point mutations, in a V H D H J H segment inserted together with its promoter into the IgH locus in inverted orientation. Our data suggest that DSBs are reaction intermediates of the mechanism underlying somatic hypermutation.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: (D) Generation and Ligation Of Adaptersmentioning

confidence: 99%

Section: (D) Generation and Ligation Of Adaptersmentioning

confidence: 99%

See 1 more Smart Citation

Indirect and direct evidence for DNA double–strand breaks in hypermutating immunoglobulin genes

Jacobs¹,

Rajewsky

Fukita

et al. 2001

Phil. Trans. R. Soc. Lond. B

View full text Add to dashboard Cite

show abstract

“…38 by Taq DNA polymerase (Invitrogen, Copenhagen, Denmark) in a reaction containing splinkerette primer-1 (5Ј-CGAAGAGTAACCGTTGC-TAGGAGAGACC) and 5Ј 32 P-labeled SRS19-6-LTR-1 (5Ј-CC-AGGCCTTGCAAGATGGCGTTACTGTAGC). Following concentration on Microcon YM-30 columns, samples were denatured and loaded on a denaturing 4.25% polyacrylamide gel that was subjected to electrophoresis.…”

Section: Identification Of Rissmentioning

confidence: 99%

“…Eif4enif1 encodes a transporter of components of the translational initiation machinery, whereas Sfi1 is involved in spindle assembly. 45,46 Identification of SRS19-6 retroviral insertion sites Using a splinkerette-aided PCR strategy, we sequenced a total of 182 SRS19-6 RISs in 67 tumors from 3 genotypes 38,47,48 (Table S1). The average number of identified RISs was unevenly distributed among the genotypes, ranging from 3.8 and 4.3 in Cebpa ϩ/ϩ and Cebpa ϩ/BRM2 mice, respectively, to only 2.1 in Cebpa BRM2/BRM2 animals (data not shown).…”

mentioning

confidence: 99%

Mutation of C/EBPα predisposes to the development of myeloid leukemia in a retroviral insertional mutagenesis screen

Hasemann

Damgaard

Schuster

et al. 2008

Blood

View full text Add to dashboard Cite

show abstract

A piggyBac transposon‐ and gateway‐enhanced system for efficient BAC transgenesis

Zhao

Koopman

2014

Developmental Dynamics

View full text Add to dashboard Cite

Background: Bacterial artificial chromosomes (BACs) have become increasingly popular vectors for making transgenic mice, as they are able to carry large genomic DNA fragments that in many cases are needed to reproduce the endogenous gene expression pattern. However, the efficiency of BAC transgenesis is generally low, and gene transfer to BAC vectors by recombination‐mediated engineering (recombineering) is time‐consuming and technically demanding. Results and Conclusions: We present an enhanced system, comprising a BAC vector retrofitted with piggyBac DNA transposon elements and attL (Gateway) docking sites, that obviates these problems. Using this system, a gene‐of‐interest (such as a reporter gene) is transferred to the vector in a one‐step in vitro reaction, and piggyBac transposition mediates transgene integration at high efficiency when microinjected into mouse zygotes with piggyBac transposase mRNA. We establish proof‐of‐principle for this system using a Wilms tumour‐1 (Wt1) BAC to drive expression of an mCherry‐2A‐EGFP (RG) reporter gene, which yielded transgenic mice at a frequency of 33%, and recapitulated endogenous WT1 expression in developing gonads, kidneys and heart. The system we describe is applicable to any BAC transgenesis strategy. Developmental Dynamics 243:1086–1094, 2014. © 2014 Wiley Periodicals, Inc.

show abstract

Splinkerettes—improved vectorettes for greater efficiency in PCR walking

Cited by 187 publications

References 160 publications

Indirect and direct evidence for DNA double–strand breaks in hypermutating immunoglobulin genes

Indirect and direct evidence for DNA double–strand breaks in hypermutating immunoglobulin genes

Mutation of C/EBPα predisposes to the development of myeloid leukemia in a retroviral insertional mutagenesis screen

A piggyBac transposon‐ and gateway‐enhanced system for efficient BAC transgenesis

Contact Info

Product

Resources

About