Specific-purpose plasmid cloning vectors I. Low copy number, temperature-sensitive, mobilization-defective pSC101-derived containment vectors

Hashimoto-Gotoh, Tamotsu; Franklin, F. Christopher H.; Nordheim, Alfred; Timmis, Kenneth N.

doi:10.1016/0378-1119(81)90079-2

Cited by 179 publications

(103 citation statements)

References 25 publications

Supporting

Mentioning

100

Contrasting

Order By: Relevance

“…Because multicopy plasmids might interfere with recombination by acting as competitive inhibitors (18), we cloned the Red genes (␥, ␤, and exo) into a low copy number plasmid. We used a vector which shows temperaturesensitive replication (37) to permit its easy curing from the resultant mutants. The plasmids pKD20 and pKD46 (Fig.…”

Section: Discussionmentioning

confidence: 99%

One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products

Datsenko

Wanner

2000

Proc. Natl. Acad. Sci. U.S.A.

13,415

13,625

View full text Add to dashboard Cite

We have developed a simple and highly efficient method to disrupt chromosomal genes in Escherichia coli in which PCR primers provide the homology to the targeted gene(s). In this procedure, recombination requires the phage Red recombinase, which is synthesized under the control of an inducible promoter on an easily curable, low copy number plasmid. To demonstrate the utility of this approach, we generated PCR products by using primers with 36-to 50-nt extensions that are homologous to regions adjacent to the gene to be inactivated and template plasmids carrying antibiotic resistance genes that are flanked by FRT (FLP recognition target) sites. By using the respective PCR products, we made 13 different disruptions of chromosomal genes. Mutants of the arcB, cyaA, lacZYA, ompR-envZ, phnR, pstB, pstCA, pstS, pstSCAB-phoU, recA, and torSTRCAD genes or operons were isolated as antibiotic-resistant colonies after the introduction into bacteria carrying a Red expression plasmid of synthetic (PCRgenerated) DNA. The resistance genes were then eliminated by using a helper plasmid encoding the FLP recombinase which is also easily curable. This procedure should be widely useful, especially in genome analysis of E. coli and other bacteria because the procedure can be done in wild-type cells.bacterial genomics ͉ FLP recombinase ͉ FRT sites ͉ Red recombinase T he availability of complete bacterial genome sequences has provided a wealth of information on the molecular structure and organization of a myriad of genes and ORFs whose functions are poorly understood. A systematic mutational analysis of genes in their normal location can provide significant insight into their function. Although a number of general allele replacement methods (1-7) can be used to inactivate bacterial chromosomal genes, these all require creating the gene disruption on a suitable plasmid before recombining it onto the chromosome. In contrast, genes can be directly disrupted in Saccharomyces cerevisiae by transformation with PCR fragments encoding a selectable marker and having only 35 nt of flanking DNA homologous to the chromosome (8). This PCR-mediated gene replacement method has greatly facilitated the generation of specific mutants in the functional analysis of the yeast genome; it relies on the high efficiency of mitotic recombination in yeast (9). Directed disruption of chromosomal genes can also be done in Candida albicans by using similar PCR fragments with 50-to 60-nt homology extensions (10).In contrast to yeast and a few naturally competent bacteria, most bacteria are not readily transformable with linear DNA. One reason Escherichia coli is not so transformable is because of the presence of intracellular exonucleases that degrade linear DNA (11). However, recombination-proficient mutants lacking exonuclease V of the RecBCD recombination complex are transformable with linear DNA (12). Recombination can occur in recB or recC mutants carrying a suppressor (sbcA or sbcB) mutation that activates an alternative recombination pathway; sbcA activates ...

show abstract

Section: Discussionmentioning

confidence: 99%

One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products

Datsenko

Wanner

2000

Proc. Natl. Acad. Sci. U.S.A.

13,415

13,625

View full text Add to dashboard Cite

show abstract

“…Media were supplemented with 100 mg ampicillin ml 21 and 0.5 % (w/v) L-arabinose. E. coli XL-1 Blue (Stratagene) harbouring pBCKS (Stratagene), pHAG (Collinson et al, 1996), pGEM-T Easy (Promega) or pHSG415 (Hashimoto-Gotoh et al, 1981) was grown at 28 or 37 uC for 24 or 48 h with agitation in Luria-Bertani (LB) broth supplemented with 50 mg chloramphenicol ml 21 or 100 mg ampicillin ml 21 and 40 mg X-Gal ml 21 , in addition to 1 mM IPTG, when required.…”

Section: Methodsmentioning

confidence: 99%

AgfC and AgfE facilitate extracellular thin aggregative fimbriae synthesis in Salmonella Enteritidis

et al. 2007

View full text Add to dashboard Cite

“…Italicized sequences correspond to regions of identity between rpoSRev2 and rpoSFor2. PCR products were purified, digested with EcoRI and HindIII, and ligated into pHSG415 (29). To generate strain ST 3b, the agfD promoter region from SE 3b was PCR amplified using primers agfD3b1 (AGTGAATTCGCTTCTTATCCGCTTCC [an EcoRI site is underlined]) and agfD3b2 (GTAAAGCTTTACTATCAAATCTAAACTTCAAA [a HindIII site is underlined]) and cloned into pHSG415.…”

Section: Methodsmentioning

confidence: 99%

Comparative Genetics of the rdar Morphotype inSalmonella

White¹,

Surette

2006

J Bacteriol

View full text Add to dashboard Cite

The Salmonella rdar morphotype is a distinct, rough and dry colony morphology formed by the extracellular interaction of thin aggregative fimbriae (Tafi or curli), cellulose, and other polysaccharides. Cells in rdar colonies are more resistant to desiccation and exogenous stresses, which is hypothesized to aid in the passage of pathogenic Salmonella spp. between hosts. Here we analyzed the genetic and phenotypic conservation of the rdar morphotype throughout the entire Salmonella genus. The rdar morphotype was conserved in 90% of 80 isolates representing all 7 Salmonella groups; however, the frequency was only 31% in a reference set of 16 strains (Salmonella reference collection C [SARC]). Comparative gene expression analysis was used to separate cis-and trans-acting effects on promoter activity for the 16 SARC strains, focusing on the 780-bp intergenic region containing divergent promoters for the master regulator of the rdar morphotype (agfD) and the Tafi structural genes (agfB). Surprisingly, promoter functionality was conserved in most isolates, and loss of the phenotype was due primarily to defects in trans-acting regulatory factors. We hypothesize that trans differences have been caused by domestication, whereas cis differences, detected for Salmonella enterica subsp. arizonae isolates, may reflect an evolutionary change in lifestyle. Our results demonstrate that the rdar morphotype is conserved throughout the salmonellae, but they also emphasize that regulation is an important source of variability among isolates.

show abstract

Specific-purpose plasmid cloning vectors I. Low copy number, temperature-sensitive, mobilization-defective pSC101-derived containment vectors

Cited by 179 publications

References 25 publications

One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products

One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products

AgfC and AgfE facilitate extracellular thin aggregative fimbriae synthesis in Salmonella Enteritidis

Comparative Genetics of the rdar Morphotype inSalmonella

Contact Info

Product

Resources

About