Smed-SmB, a member of the LSm protein superfamily, is essential for chromatoid body organization and planarian stem cell proliferation

Fernandéz-Taboada, Enrique; Moritz, Sören; Zeuschner, Dagmar; Stehling, Martin; Schöler, Hans R.; Saló, Emili; Gentile, Luca

doi:10.1242/dev.042564

Cited by 65 publications

(38 citation statements)

References 56 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our biochemical and sequence analyses suggest that both SMEDWI-3 and Sm protein family members are methylated in planarians. Recent work has shown that both SmB and PIWI are required for neoblast function (Fernandez-Taboada et al, 2010;Palakodeti et al, 2008;Reddien et al, 2005a). Furthermore, SmB was shown to localize to planarian CBs (Fernandez-Taboada et al, 2010) and our results suggest that the same is true for sDMA-SMEDWI-3.…”

Section: Planarian Chromatoid Body Function and The Role Of Methylationsupporting

confidence: 75%

“…Many studies have identified genes required for neoblast maintenance and function in planarians (Bonuccelli et al, 2010;Conte et al, 2009;Fernandez-Taboada et al, 2010;Guo et al, 2006;Oviedo and Levin, 2007;Palakodeti et al, 2008;Pearson and Sanchez Alvarado, 2010;Reddien et al, 2005a;Reddien et al, 2005b;Rouhana et al, 2010;Salvetti et al, 2005;Scimone et al, 2010;Solana et al, 2009;Tasaki et al, 2011a;Tasaki et al, 2011b). The vast majority of genes required specifically for neoblast function encode conserved factors involved in post-transcriptional regulation of gene expression (reviewed by Shibata et al, 2010).…”

Section: Introductionmentioning

confidence: 99%

“…CBs contain conserved post-transcriptional regulators, such as the DEAD box RNA helicase CBC-1 (CB component-1/Me31b/Dhh1/DDX6) (Yoshida-Kashikawa et al, 2007), the small nuclear ribonucleoproteins (snRNP) core protein SmB (Fernandez-Taboada et al, 2010) and a Tudor homolog (Spoltud-1; Solana et al, 2009). All of these factors are required for regeneration in planarians (Fernandez-Taboada et al, 2010;Rouhana et al, 2010;Solana et al, 2009).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

PRMT5 and the role of symmetrical dimethylarginine in chromatoid bodies of planarian stem cells

et al. 2012

View full text Add to dashboard Cite

Planarian flatworms contain a population of adult stem cells (neoblasts) that proliferate and generate cells of all tissues during growth, regeneration and tissue homeostasis. A characteristic feature of neoblasts is the presence of chromatoid bodies, large cytoplasmic ribonucleoprotein (RNP) granules morphologically similar to structures present in the germline of many organisms. This study aims to reveal the function, and identify additional components, of planarian chromatoid bodies. We uncover the presence of symmetrical dimethylarginine (sDMA) on chromatoid body components and identify the ortholog of protein arginine methyltransferase PRMT5 as the enzyme responsible for sDMA modification in these proteins. RNA interference-mediated depletion of planarian PRMT5 results in defects in homeostasis and regeneration, reduced animal size, reduced number of neoblasts, fewer chromatoid bodies and increased levels of transposon and repetitive-element transcripts. Our results suggest that PIWI family member SMEDWI-3 is one sDMA-containing chromatoid body protein for which methylation depends on PRMT5. Additionally, we discover an RNA localized to chromatoid bodies, germinal histone H4. Our results reveal new components of chromatoid bodies and their function in planarian stem cells, and also support emerging studies indicative of sDMA function in stabilization of RNP granules and the Piwi-interacting RNA pathway.

show abstract

Section: Planarian Chromatoid Body Function and The Role Of Methylationsupporting

confidence: 75%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

PRMT5 and the role of symmetrical dimethylarginine in chromatoid bodies of planarian stem cells

et al. 2012

View full text Add to dashboard Cite

show abstract

“…Planarians used in these experiments were from a clonal strain of the S. Mediterranea BCN-10 biotype and were maintained as previously described [68]. Planarians were starved for 1 week and were 4 to 6 mm in length when used for experiments.…”

Section: Methodsmentioning

confidence: 99%

JNK Controls the Onset of Mitosis in Planarian Stem Cells and Triggers Apoptotic Cell Death Required for Regeneration and Remodeling

et al. 2014

View full text Add to dashboard Cite

Regeneration of lost tissues depends on the precise interpretation of molecular signals that control and coordinate the onset of proliferation, cellular differentiation and cell death. However, the nature of those molecular signals and the mechanisms that integrate the cellular responses remain largely unknown. The planarian flatworm is a unique model in which regeneration and tissue renewal can be comprehensively studied in vivo. The presence of a population of adult pluripotent stem cells combined with the ability to decode signaling after wounding enable planarians to regenerate a complete, correctly proportioned animal within a few days after any kind of amputation, and to adapt their size to nutritional changes without compromising functionality. Here, we demonstrate that the stress-activated c-jun–NH2–kinase (JNK) links wound-induced apoptosis to the stem cell response during planarian regeneration. We show that JNK modulates the expression of wound-related genes, triggers apoptosis and attenuates the onset of mitosis in stem cells specifically after tissue loss. Furthermore, in pre-existing body regions, JNK activity is required to establish a positive balance between cell death and stem cell proliferation to enable tissue renewal, remodeling and the maintenance of proportionality. During homeostatic degrowth, JNK RNAi blocks apoptosis, resulting in impaired organ remodeling and rescaling. Our findings indicate that JNK-dependent apoptotic cell death is crucial to coordinate tissue renewal and remodeling required to regenerate and to maintain a correctly proportioned animal. Hence, JNK might act as a hub, translating wound signals into apoptotic cell death, controlled stem cell proliferation and differentiation, all of which are required to coordinate regeneration and tissue renewal.

show abstract

“…Then, gene expression was calculated as follows. Mean Ct values were normalized to the control housekeeping gene Smed-Ef2 (CAGCCAGTAGCTTTAAGCGATG, ACTCTCAACGCTGCTGTCACTTC) (Solana et al, 2012, Forsthoefel et al, 2012, Solana et al, 2013, Fernandez-Taboada et al, 2010) and were used to calculate relative expression (Forsthoefel et al, 2012). With the exception of experiments investigating at expression kinetics, gene expression was assessed 12 hours post-infection for Smed-p38 MAP-Kinase , 6 hours post-infection for Smed-morn2, and 24 hours post-infection with bacteria for Smed-setd8-1 and Smed-PGRP-2, -1, -3, and -4 .…”

Section: Methodsmentioning

confidence: 99%

Staphylococcus aureus Promotes Smed-PGRP-2/Smed-setd8-1 Methyltransferase Signalling in Planarian Neoblasts to Sensitize Anti-bacterial Gene Responses During Re-infection

et al. 2017

View full text Add to dashboard Cite

Little is known about how organisms exposed to recurrent infections adapt their innate immune responses. Here, we report that planarians display a form of instructed immunity to primo-infection by Staphylococcus aureus that consists of a transient state of heightened resistance to re-infection that persists for approximately 30 days after primo-infection. We established the involvement of stem cell-like neoblasts in this instructed immunity using the complementary approaches of RNA-interference-mediated cell depletion and tissue grafting-mediated gain of function. Mechanistically, primo-infection leads to expression of the peptidoglycan receptor Smed-PGRP-2, which in turn promotes Smed-setd8-1 histone methyltransferase expression and increases levels of lysine methylation in neoblasts. Depletion of neoblasts did not affect S. aureus clearance in primo-infection but, in re-infection, abrogated the heightened elimination of bacteria and reduced Smed-PGRP-2 and Smed-setd8-1 expression. Smed-PGRP-2 and Smed-setd8-1 sensitize animals to heightened expression of Smed-p38 MAPK and Smed-morn2, which are downstream components of anti-bacterial responses. Our study reveals a central role of neoblasts in innate immunity against S. aureus to establish a resistance state facilitating Smed-sted8-1-dependent expression of anti-bacterial genes during re-infection.

show abstract

Smed-SmB, a member of the LSm protein superfamily, is essential for chromatoid body organization and planarian stem cell proliferation

Cited by 65 publications

References 56 publications

PRMT5 and the role of symmetrical dimethylarginine in chromatoid bodies of planarian stem cells

PRMT5 and the role of symmetrical dimethylarginine in chromatoid bodies of planarian stem cells

JNK Controls the Onset of Mitosis in Planarian Stem Cells and Triggers Apoptotic Cell Death Required for Regeneration and Remodeling

Staphylococcus aureus Promotes Smed-PGRP-2/Smed-setd8-1 Methyltransferase Signalling in Planarian Neoblasts to Sensitize Anti-bacterial Gene Responses During Re-infection

Contact Info

Product

Resources

About