Sideroblastic anemia: functional study of two novel missense mutations in ALAS2

Abstract

BackgroundX‐linked sideroblastic anemia (XLSA) is a disorder characterized by decreased heme synthesis and mitochondrial iron overload with ringed sideroblasts in bone marrow. XLSA is caused by mutations in the erythroid‐specific gene coding 5‐aminolevulinate synthase (ALAS2). Anemia in XLSA is extremely variable, characteristically microcytic and hypochromic with poikilocytosis, and the red blood cell distribution width is increased and prominent dimorphism of the red cell population. Anemia in XLSA patients responds variably to supplementation with pyridoxine.Methods and ResultsWe report four patients with XLSA and three mutations in ALAS2: c.611G>A (p.Arg204Gln), c.1218G>T (p.Leu406Phe) and c.1499A>G (p.Tyr500Cys). The in silico predictions of three ALAS2 mutations and the functional consequences of two ALAS2 mutations were assessed. We performed in silico analysis of these mutations using ten different softwares, and all of them predicted that the p.Tyr500Cys mutation was deleterious. The in vitro prokaryotic expression showed that the p.Leu406Phe and p.Tyr500Cys mutations reduced the ALAS2 specific activity (SA) to 14% and 7% of the control value, respectively.ConclusionIn view of the results obtained in this study, a clear relationship between genotype and phenotype cannot be established; clinical variability or severity of anemia may be influenced by allelic variants in other genes or transcription factors and environmental conditions.

Missense variants in ALAS2 gene in five patients

“…Hematologists diagnosed patients with SAs based on the presence of ring sideroblasts in the bone marrow aspirate smear. We performed the genetic study in eighteen unrelated patients; some results have yet been published …”

“…We used the vector pKK223‐3 (Pharmacia Biotechnology, Piscataway, NJ, USA) and Escherichia coli JM109 competent cells (Promega Corporation, Madison WI, USA). Bacterial growth, isopropyl b‐D‐thiogalactoside induction, and ALAS2 activity were made as we described . The specific activity (SA) of each ALAS2 construction was expressed in nmol ALA/mg total protein per hour.…”

“…We performed the human androgen receptor gene polymorphism on genomic DNA from peripheral blood samples of female patients 1, 4, and 5, and the daughter and son of patient 5, to assess the X chromosome inactivation we described in Mendez et al 4 DNA of each patient was digested with HpaII and then amplified with a labeled-forward oligonucleotide-FAM and an unlabeledreverse oligonucleotide for the androgen receptor locus. The PCR products were analyzed on GeneMapper Generic Module using the MLPA analysis method (Genetic Analyzer 3130; Thermo Fisher Scientific, Waltham, MA, USA).…”

“…We performed the genetic study in eighteen unrelated patients; some results have yet been published. 4,5…”

“…Variant ALAS2 constructs were made by PCR site-directed mutagenesis using the normal ALAS2 construct and in vitro expression of normal and mutant ALAS2 was made as we described in Mendez et al 4 The variants c.485A>G, c.971T>C, and c.1094A>G were introduced with the following sense oligonucleotides, the nucleotide change is underlined: GGATCACACCTGCCGTGTGTTCAAG, CCCTAAGATACCCAAAACTGTGGCC, and CATGCTGTAGGACTGTG TGGGTCC, respectively, and their antisense oligonucleotides. We used the vector pKK223-3 (Pharmacia Biotechnology, Piscataway, NJ, USA) and Escherichia coli JM109 competent cells (Promega Corporation, Madison WI, USA).…”